Incidental Mutation 'R7948:Prickle2'
ID615969
Institutional Source Beutler Lab
Gene Symbol Prickle2
Ensembl Gene ENSMUSG00000030020
Gene Nameprickle planar cell polarity protein 2
Synonyms6230400G14Rik, mpk2, 6720451F06Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R7948 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location92370908-92706155 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92416922 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 257 (I257V)
Ref Sequence ENSEMBL: ENSMUSP00000032093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032093] [ENSMUST00000113445] [ENSMUST00000113446] [ENSMUST00000113447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032093
AA Change: I257V

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: I257V

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:PET 76 176 1.2e-45 PFAM
LIM 185 242 3.05e-10 SMART
LIM 250 302 5.43e-16 SMART
LIM 310 365 2.92e-7 SMART
low complexity region 465 477 N/A INTRINSIC
low complexity region 534 546 N/A INTRINSIC
low complexity region 725 753 N/A INTRINSIC
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113445
AA Change: I201V

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109072
Gene: ENSMUSG00000030020
AA Change: I201V

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113446
AA Change: I201V

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109073
Gene: ENSMUSG00000030020
AA Change: I201V

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113447
AA Change: I201V

PolyPhen 2 Score 0.313 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109074
Gene: ENSMUSG00000030020
AA Change: I201V

DomainStartEndE-ValueType
Pfam:PET 17 122 8.9e-47 PFAM
LIM 129 186 3.05e-10 SMART
LIM 194 246 5.43e-16 SMART
LIM 254 309 2.92e-7 SMART
low complexity region 409 421 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 669 697 N/A INTRINSIC
low complexity region 776 785 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik CGGTCTAGCTGAGCAGGAGGCAGCTCAGG CGG 14: 70,157,366 probably null Het
Abca8a A T 11: 110,050,979 Y1155N probably benign Het
Adcy8 C T 15: 64,815,350 R435K possibly damaging Het
Adgrv1 C A 13: 81,559,529 V1253F probably damaging Het
Adgrv1 T C 13: 81,559,588 D1233G probably damaging Het
Baz2a G A 10: 128,125,325 R1639H possibly damaging Het
Ccdc125 A G 13: 100,696,402 T496A probably benign Het
Cntnap5a A G 1: 116,580,528 M1257V probably benign Het
Cpne3 A G 4: 19,528,186 probably null Het
Cts3 T C 13: 61,566,049 E288G probably benign Het
Deup1 T C 9: 15,610,648 K74E possibly damaging Het
Epn1 T A 7: 5,089,993 Y101* probably null Het
Ercc4 A G 16: 13,130,185 D422G probably benign Het
Exoc6 A C 19: 37,576,974 N166T probably benign Het
Fam89a T C 8: 124,751,670 Y47C probably damaging Het
Fbn1 C A 2: 125,341,299 Q1753H probably damaging Het
Gal3st4 C T 5: 138,271,000 R66Q probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Golm1 C A 13: 59,664,197 probably null Het
Gtpbp3 A G 8: 71,492,586 H434R probably damaging Het
Hbegf A G 18: 36,506,699 L194S possibly damaging Het
Igsf10 A G 3: 59,331,858 S301P probably benign Het
Il9r A C 11: 32,194,486 C106W probably damaging Het
Lama5 T C 2: 180,202,201 D389G probably damaging Het
Lyst T A 13: 13,746,589 D3373E possibly damaging Het
Mkrn1 T A 6: 39,400,410 Y361F probably benign Het
Muc16 A T 9: 18,642,490 I4169N unknown Het
Myo7a C T 7: 98,075,029 G1150S probably damaging Het
Myom2 A G 8: 15,085,306 D503G probably benign Het
Nmnat3 A G 9: 98,399,482 I46V probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nrros A T 16: 32,162,258 N17K unknown Het
Olfr33 C T 7: 102,713,688 V242I probably benign Het
Patj A T 4: 98,424,310 K295M probably damaging Het
Pax6 A G 2: 105,685,877 T167A probably benign Het
Pclo T A 5: 14,765,166 L1212* probably null Het
Peg3 T A 7: 6,708,782 Y1147F probably damaging Het
Ppp2r5c T A 12: 110,465,986 N77K probably benign Het
Ptprc G A 1: 138,064,576 T1132I probably benign Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Skiv2l2 C T 13: 112,921,762 R45Q probably benign Het
Slc6a15 T A 10: 103,404,295 M293K possibly damaging Het
Tmem131 A T 1: 36,794,148 W1749R probably damaging Het
Trpm8 T A 1: 88,374,369 Y1020* probably null Het
Ttn G T 2: 76,768,179 Y19463* probably null Het
Tubgcp5 T A 7: 55,794,248 D18E probably benign Het
Ubtd1 T A 19: 42,033,735 F149I probably benign Het
Xirp2 A G 2: 67,519,314 K3279R possibly damaging Het
Zfp236 T C 18: 82,624,415 T1117A probably damaging Het
Zfp945 A T 17: 22,852,122 C289S unknown Het
Other mutations in Prickle2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02962:Prickle2 APN 6 92376422 missense probably benign 0.00
R0028:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R0122:Prickle2 UTSW 6 92411345 nonsense probably null
R0555:Prickle2 UTSW 6 92458565 missense probably benign 0.02
R0940:Prickle2 UTSW 6 92411003 missense probably benign 0.02
R1394:Prickle2 UTSW 6 92376382 missense possibly damaging 0.87
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1470:Prickle2 UTSW 6 92458602 missense probably damaging 0.96
R1599:Prickle2 UTSW 6 92410874 missense probably benign
R1745:Prickle2 UTSW 6 92376593 missense probably damaging 1.00
R1801:Prickle2 UTSW 6 92416904 missense probably damaging 0.98
R1985:Prickle2 UTSW 6 92411452 missense probably damaging 1.00
R2085:Prickle2 UTSW 6 92376364 missense probably damaging 0.96
R2147:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2148:Prickle2 UTSW 6 92425671 missense probably damaging 0.99
R2571:Prickle2 UTSW 6 92705400 missense probably benign 0.09
R3547:Prickle2 UTSW 6 92411137 missense probably damaging 1.00
R4356:Prickle2 UTSW 6 92411509 missense probably damaging 1.00
R4569:Prickle2 UTSW 6 92422342 missense probably benign 0.12
R4896:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5004:Prickle2 UTSW 6 92416755 missense probably benign 0.26
R5045:Prickle2 UTSW 6 92376394 missense probably damaging 0.96
R5219:Prickle2 UTSW 6 92376530 missense probably benign
R5247:Prickle2 UTSW 6 92375969 missense probably damaging 1.00
R5280:Prickle2 UTSW 6 92376210 missense probably damaging 1.00
R5334:Prickle2 UTSW 6 92425684 missense probably damaging 1.00
R5780:Prickle2 UTSW 6 92458612 missense probably benign 0.06
R5960:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R6084:Prickle2 UTSW 6 92416848 nonsense probably null
R6362:Prickle2 UTSW 6 92458615 missense possibly damaging 0.77
R6368:Prickle2 UTSW 6 92420237 missense probably damaging 1.00
R6852:Prickle2 UTSW 6 92376544 missense probably benign
R7041:Prickle2 UTSW 6 92376305 missense probably benign 0.08
R7203:Prickle2 UTSW 6 92410978 missense possibly damaging 0.61
R7352:Prickle2 UTSW 6 92410890 missense probably benign 0.00
R7405:Prickle2 UTSW 6 92458543 missense probably damaging 0.96
R7510:Prickle2 UTSW 6 92376470 missense possibly damaging 0.58
R7562:Prickle2 UTSW 6 92375948 makesense probably null
R7578:Prickle2 UTSW 6 92411290 missense probably benign 0.32
R7614:Prickle2 UTSW 6 92425650 missense possibly damaging 0.46
R7732:Prickle2 UTSW 6 92411224 missense probably damaging 1.00
X0020:Prickle2 UTSW 6 92416853 missense probably damaging 0.98
X0026:Prickle2 UTSW 6 92411426 nonsense probably null
X0066:Prickle2 UTSW 6 92376433 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCACAGGTATCACAATATTCTG -3'
(R):5'- TGGTAGACCATTAGCTCTCCAC -3'

Sequencing Primer
(F):5'- TTCTGCATACAGGGACTCAAAG -3'
(R):5'- GACCATTAGCTCTCCACTAAAATGTG -3'
Posted On2020-01-23