Mutagenetix > Incidental Mutation

Incidental Mutation 'R7948:Tubgcp5'

615972

Institutional Source

Beutler Lab

Gene Symbol

Tubgcp5

Ensembl Gene

ENSMUSG00000033790

Gene Name

tubulin, gamma complex associated protein 5

Synonyms

B130010C12Rik, GCP5

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R7948 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55794154-55831677 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 55794248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 18 (D18E)

Ref Sequence

ENSEMBL: ENSMUSP00000032627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206191] [ENSMUST00000206454]

AlphaFold

Q8BKN5

Predicted Effect

probably benign
Transcript: ENSMUST00000032627
AA Change: D18E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: D18E

Domain	Start	End	E-Value	Type
low complexity region	109	124	N/A	INTRINSIC
Pfam:Spc97_Spc98	273	942	1.2e-126	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205796
AA Change: D18E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000206191
AA Change: D18E

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206454
AA Change: D8E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930012K11Rik	CGGTCTAGCTGAGCAGGAGGCAGCTCAGG	CGG	14: 70,157,366		probably null	Het
Abca8a	A	T	11: 110,050,979	Y1155N	probably benign	Het
Adcy8	C	T	15: 64,815,350	R435K	possibly damaging	Het
Adgrv1	C	A	13: 81,559,529	V1253F	probably damaging	Het
Adgrv1	T	C	13: 81,559,588	D1233G	probably damaging	Het
Baz2a	G	A	10: 128,125,325	R1639H	possibly damaging	Het
Ccdc125	A	G	13: 100,696,402	T496A	probably benign	Het
Cntnap5a	A	G	1: 116,580,528	M1257V	probably benign	Het
Cpne3	A	G	4: 19,528,186		probably null	Het
Cts3	T	C	13: 61,566,049	E288G	probably benign	Het
Deup1	T	C	9: 15,610,648	K74E	possibly damaging	Het
Epn1	T	A	7: 5,089,993	Y101*	probably null	Het
Ercc4	A	G	16: 13,130,185	D422G	probably benign	Het
Exoc6	A	C	19: 37,576,974	N166T	probably benign	Het
Fam89a	T	C	8: 124,751,670	Y47C	probably damaging	Het
Fbn1	C	A	2: 125,341,299	Q1753H	probably damaging	Het
Gal3st4	C	T	5: 138,271,000	R66Q	probably benign	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Golm1	C	A	13: 59,664,197		probably null	Het
Gtpbp3	A	G	8: 71,492,586	H434R	probably damaging	Het
Hbegf	A	G	18: 36,506,699	L194S	possibly damaging	Het
Igsf10	A	G	3: 59,331,858	S301P	probably benign	Het
Il9r	A	C	11: 32,194,486	C106W	probably damaging	Het
Lama5	T	C	2: 180,202,201	D389G	probably damaging	Het
Lyst	T	A	13: 13,746,589	D3373E	possibly damaging	Het
Mkrn1	T	A	6: 39,400,410	Y361F	probably benign	Het
Muc16	A	T	9: 18,642,490	I4169N	unknown	Het
Myo7a	C	T	7: 98,075,029	G1150S	probably damaging	Het
Myom2	A	G	8: 15,085,306	D503G	probably benign	Het
Nmnat3	A	G	9: 98,399,482	I46V	probably benign	Het
Nrp2	C	T	1: 62,745,408	R239C	probably damaging	Het
Nrros	A	T	16: 32,162,258	N17K	unknown	Het
Olfr33	C	T	7: 102,713,688	V242I	probably benign	Het
Patj	A	T	4: 98,424,310	K295M	probably damaging	Het
Pax6	A	G	2: 105,685,877	T167A	probably benign	Het
Pclo	T	A	5: 14,765,166	L1212*	probably null	Het
Peg3	T	A	7: 6,708,782	Y1147F	probably damaging	Het
Ppp2r5c	T	A	12: 110,465,986	N77K	probably benign	Het
Prickle2	T	C	6: 92,416,922	I257V	possibly damaging	Het
Ptprc	G	A	1: 138,064,576	T1132I	probably benign	Het
Serpinb6a	G	A	13: 33,923,020	S183L	probably benign	Het
Skiv2l2	C	T	13: 112,921,762	R45Q	probably benign	Het
Slc6a15	T	A	10: 103,404,295	M293K	possibly damaging	Het
Tmem131	A	T	1: 36,794,148	W1749R	probably damaging	Het
Trpm8	T	A	1: 88,374,369	Y1020*	probably null	Het
Ttn	G	T	2: 76,768,179	Y19463*	probably null	Het
Ubtd1	T	A	19: 42,033,735	F149I	probably benign	Het
Xirp2	A	G	2: 67,519,314	K3279R	possibly damaging	Het
Zfp236	T	C	18: 82,624,415	T1117A	probably damaging	Het
Zfp945	A	T	17: 22,852,122	C289S	unknown	Het

Other mutations in Tubgcp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Tubgcp5	APN	7	55806595	missense	possibly damaging	0.91
IGL01291:Tubgcp5	APN	7	55808529	missense	possibly damaging	0.83
IGL01343:Tubgcp5	APN	7	55796031	splice site	probably benign
IGL01597:Tubgcp5	APN	7	55806832	splice site	probably benign
IGL01688:Tubgcp5	APN	7	55815018	missense	possibly damaging	0.92
IGL01843:Tubgcp5	APN	7	55799473	missense	probably benign	0.02
IGL01950:Tubgcp5	APN	7	55806088	missense	possibly damaging	0.93
IGL01957:Tubgcp5	APN	7	55818757	missense	probably damaging	1.00
IGL02902:Tubgcp5	APN	7	55806607	nonsense	probably null
IGL03105:Tubgcp5	APN	7	55825581	missense	probably damaging	1.00
ANU05:Tubgcp5	UTSW	7	55808529	missense	possibly damaging	0.83
R0078:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R0322:Tubgcp5	UTSW	7	55814978	missense	probably damaging	0.98
R0362:Tubgcp5	UTSW	7	55800684	missense	probably damaging	1.00
R0449:Tubgcp5	UTSW	7	55823567	missense	probably benign
R0488:Tubgcp5	UTSW	7	55829338	missense	probably damaging	0.96
R0853:Tubgcp5	UTSW	7	55814851	splice site	probably benign
R0885:Tubgcp5	UTSW	7	55806055	nonsense	probably null
R1483:Tubgcp5	UTSW	7	55825707	critical splice donor site	probably null
R1746:Tubgcp5	UTSW	7	55808537	missense	probably benign	0.05
R1766:Tubgcp5	UTSW	7	55815020	missense	probably benign	0.15
R2148:Tubgcp5	UTSW	7	55799511	missense	probably damaging	1.00
R2229:Tubgcp5	UTSW	7	55830881	missense	probably damaging	1.00
R3766:Tubgcp5	UTSW	7	55830866	missense	probably damaging	0.98
R4154:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R4838:Tubgcp5	UTSW	7	55794185	unclassified	probably benign
R4948:Tubgcp5	UTSW	7	55806123	missense	probably benign	0.00
R5110:Tubgcp5	UTSW	7	55808637	missense	probably damaging	0.96
R5347:Tubgcp5	UTSW	7	55823685	missense	probably damaging	1.00
R5417:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R5574:Tubgcp5	UTSW	7	55805329	missense	probably benign	0.01
R5758:Tubgcp5	UTSW	7	55818895	missense	probably damaging	1.00
R5957:Tubgcp5	UTSW	7	55814962	missense	probably benign	0.03
R6014:Tubgcp5	UTSW	7	55823609	missense	probably benign
R6141:Tubgcp5	UTSW	7	55806778	missense	probably benign	0.30
R6289:Tubgcp5	UTSW	7	55795923	missense	probably benign	0.05
R6511:Tubgcp5	UTSW	7	55817392	nonsense	probably null
R6563:Tubgcp5	UTSW	7	55825661	missense	possibly damaging	0.90
R6574:Tubgcp5	UTSW	7	55823583	missense	probably benign
R6596:Tubgcp5	UTSW	7	55806634	missense	probably benign	0.38
R7016:Tubgcp5	UTSW	7	55794229	missense	possibly damaging	0.76
R7038:Tubgcp5	UTSW	7	55805366	missense	probably damaging	0.99
R7075:Tubgcp5	UTSW	7	55829407	missense	probably benign	0.04
R7083:Tubgcp5	UTSW	7	55800695	nonsense	probably null
R7213:Tubgcp5	UTSW	7	55806112	missense	probably damaging	0.97
R7284:Tubgcp5	UTSW	7	55823567	missense	probably benign
R7600:Tubgcp5	UTSW	7	55808513	missense	probably benign
R7813:Tubgcp5	UTSW	7	55800696	missense	possibly damaging	0.49
R7920:Tubgcp5	UTSW	7	55816562	missense	probably benign	0.00
R8438:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R8499:Tubgcp5	UTSW	7	55804615	missense	possibly damaging	0.67
R9087:Tubgcp5	UTSW	7	55817358	missense	probably damaging	1.00
R9211:Tubgcp5	UTSW	7	55806583	missense	probably benign	0.05
R9269:Tubgcp5	UTSW	7	55795945	missense	possibly damaging	0.94
R9329:Tubgcp5	UTSW	7	55829433	critical splice donor site	probably null
R9355:Tubgcp5	UTSW	7	55817429	critical splice donor site	probably null
R9498:Tubgcp5	UTSW	7	55813485	missense	possibly damaging	0.46
R9687:Tubgcp5	UTSW	7	55825579	critical splice acceptor site	probably null
Z1088:Tubgcp5	UTSW	7	55815101	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGCTGTCTGAAGACTCTCGG -3'
(R):5'- AACTGCGGGTTTCTCGCAAG -3'

Sequencing Primer
(F):5'- ATTTCCCGGTGTGCAAGCAG -3'
(R):5'- GGTTTCTCGCAAGGGCAC -3'

Posted On

2020-01-23