Incidental Mutation 'R7948:Myo7a'
ID615973
Institutional Source Beutler Lab
Gene Symbol Myo7a
Ensembl Gene ENSMUSG00000030761
Gene Namemyosin VIIA
SynonymsMyo7, nmf371, polka, Hdb, USH1B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7948 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location98051060-98119524 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 98075029 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1150 (G1150S)
Ref Sequence ENSEMBL: ENSMUSP00000082046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084979] [ENSMUST00000107122] [ENSMUST00000107127] [ENSMUST00000107128] [ENSMUST00000205746]
Predicted Effect probably damaging
Transcript: ENSMUST00000084979
AA Change: G1150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082046
Gene: ENSMUSG00000030761
AA Change: G1150S

DomainStartEndE-ValueType
MYSc 48 731 N/A SMART
IQ 732 754 2.99e0 SMART
IQ 755 777 8.77e-7 SMART
IQ 801 823 8e0 SMART
IQ 824 846 8.7e0 SMART
low complexity region 854 889 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 972 985 N/A INTRINSIC
MyTH4 1006 1242 1.4e-71 SMART
B41 1243 1458 8.82e-42 SMART
SH3 1557 1622 4.93e-7 SMART
MyTH4 1698 1847 3.95e-57 SMART
B41 1849 2066 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107122
AA Change: G1156S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102739
Gene: ENSMUSG00000030761
AA Change: G1156S

DomainStartEndE-ValueType
MYSc 48 737 N/A SMART
IQ 738 760 2.99e0 SMART
IQ 761 783 8.77e-7 SMART
IQ 807 829 8e0 SMART
IQ 830 852 8.7e0 SMART
low complexity region 860 895 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 978 991 N/A INTRINSIC
MyTH4 1012 1248 1.4e-71 SMART
B41 1249 1464 8.82e-42 SMART
SH3 1563 1628 4.93e-7 SMART
MyTH4 1704 1853 3.95e-57 SMART
B41 1855 2072 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107127
AA Change: G1161S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102744
Gene: ENSMUSG00000030761
AA Change: G1161S

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1568 1633 4.93e-7 SMART
MyTH4 1709 1858 3.95e-57 SMART
B41 1860 2077 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107128
AA Change: G1161S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102745
Gene: ENSMUSG00000030761
AA Change: G1161S

DomainStartEndE-ValueType
MYSc 59 742 N/A SMART
IQ 743 765 2.99e0 SMART
IQ 766 788 8.77e-7 SMART
IQ 812 834 8e0 SMART
IQ 835 857 8.7e0 SMART
low complexity region 865 900 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
MyTH4 1017 1253 1.4e-71 SMART
B41 1254 1469 8.82e-42 SMART
SH3 1606 1671 4.93e-7 SMART
MyTH4 1747 1896 3.95e-57 SMART
B41 1898 2115 8.27e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205746
AA Change: G1150S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myosin gene family. Myosins are mechanochemical proteins characterized by the presence of a motor domain, an actin-binding domain, a neck domain that interacts with other proteins, and a tail domain that serves as an anchor. This gene encodes an unconventional myosin with a very short tail. Defects in this gene are associated with the mouse shaker-1 phenotype and the human Usher syndrome 1B which are characterized by deafness, reduced vestibular function, and (in human) retinal degeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: A number of spontaneous and ENU-induced mutations cause head-shaking, circling and deafness, often associated with cochlear hair cell degeneration and stereocilia anomalies. Defects in retinal pigment epithelial cells, male infertility, and light-inducedphotoreceptor damage have also been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik CGGTCTAGCTGAGCAGGAGGCAGCTCAGG CGG 14: 70,157,366 probably null Het
Abca8a A T 11: 110,050,979 Y1155N probably benign Het
Adcy8 C T 15: 64,815,350 R435K possibly damaging Het
Adgrv1 C A 13: 81,559,529 V1253F probably damaging Het
Adgrv1 T C 13: 81,559,588 D1233G probably damaging Het
Baz2a G A 10: 128,125,325 R1639H possibly damaging Het
Ccdc125 A G 13: 100,696,402 T496A probably benign Het
Cntnap5a A G 1: 116,580,528 M1257V probably benign Het
Cpne3 A G 4: 19,528,186 probably null Het
Cts3 T C 13: 61,566,049 E288G probably benign Het
Deup1 T C 9: 15,610,648 K74E possibly damaging Het
Epn1 T A 7: 5,089,993 Y101* probably null Het
Ercc4 A G 16: 13,130,185 D422G probably benign Het
Exoc6 A C 19: 37,576,974 N166T probably benign Het
Fam89a T C 8: 124,751,670 Y47C probably damaging Het
Fbn1 C A 2: 125,341,299 Q1753H probably damaging Het
Gal3st4 C T 5: 138,271,000 R66Q probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Golm1 C A 13: 59,664,197 probably null Het
Gtpbp3 A G 8: 71,492,586 H434R probably damaging Het
Hbegf A G 18: 36,506,699 L194S possibly damaging Het
Igsf10 A G 3: 59,331,858 S301P probably benign Het
Il9r A C 11: 32,194,486 C106W probably damaging Het
Lama5 T C 2: 180,202,201 D389G probably damaging Het
Lyst T A 13: 13,746,589 D3373E possibly damaging Het
Mkrn1 T A 6: 39,400,410 Y361F probably benign Het
Muc16 A T 9: 18,642,490 I4169N unknown Het
Myom2 A G 8: 15,085,306 D503G probably benign Het
Nmnat3 A G 9: 98,399,482 I46V probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nrros A T 16: 32,162,258 N17K unknown Het
Olfr33 C T 7: 102,713,688 V242I probably benign Het
Patj A T 4: 98,424,310 K295M probably damaging Het
Pax6 A G 2: 105,685,877 T167A probably benign Het
Pclo T A 5: 14,765,166 L1212* probably null Het
Peg3 T A 7: 6,708,782 Y1147F probably damaging Het
Ppp2r5c T A 12: 110,465,986 N77K probably benign Het
Prickle2 T C 6: 92,416,922 I257V possibly damaging Het
Ptprc G A 1: 138,064,576 T1132I probably benign Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Skiv2l2 C T 13: 112,921,762 R45Q probably benign Het
Slc6a15 T A 10: 103,404,295 M293K possibly damaging Het
Tmem131 A T 1: 36,794,148 W1749R probably damaging Het
Trpm8 T A 1: 88,374,369 Y1020* probably null Het
Ttn G T 2: 76,768,179 Y19463* probably null Het
Tubgcp5 T A 7: 55,794,248 D18E probably benign Het
Ubtd1 T A 19: 42,033,735 F149I probably benign Het
Xirp2 A G 2: 67,519,314 K3279R possibly damaging Het
Zfp236 T C 18: 82,624,415 T1117A probably damaging Het
Zfp945 A T 17: 22,852,122 C289S unknown Het
Other mutations in Myo7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Myo7a APN 7 98102626 missense probably damaging 1.00
IGL00785:Myo7a APN 7 98054348 missense probably damaging 0.99
IGL00840:Myo7a APN 7 98051659 missense probably benign 0.25
IGL01362:Myo7a APN 7 98097702 missense probably damaging 1.00
IGL01484:Myo7a APN 7 98085422 missense probably damaging 1.00
IGL01673:Myo7a APN 7 98054708 missense probably benign 0.00
IGL01933:Myo7a APN 7 98083142 missense probably damaging 1.00
IGL01943:Myo7a APN 7 98065647 missense possibly damaging 0.96
IGL02188:Myo7a APN 7 98091027 missense probably damaging 0.96
IGL02304:Myo7a APN 7 98077736 missense possibly damaging 0.89
IGL02305:Myo7a APN 7 98051629 makesense probably null
IGL02331:Myo7a APN 7 98053182 missense possibly damaging 0.95
IGL02386:Myo7a APN 7 98075112 missense probably damaging 0.99
IGL02389:Myo7a APN 7 98106991 critical splice donor site probably null
IGL02832:Myo7a APN 7 98091020 critical splice donor site probably null
IGL02839:Myo7a APN 7 98091122 missense probably damaging 1.00
IGL03193:Myo7a APN 7 98091057 missense probably damaging 1.00
IGL03237:Myo7a APN 7 98102593 missense probably damaging 1.00
IGL03384:Myo7a APN 7 98093593 missense probably damaging 1.00
coward UTSW 7 98085466 missense probably damaging 1.00
H8786:Myo7a UTSW 7 98095778 missense possibly damaging 0.61
IGL03046:Myo7a UTSW 7 98079327 missense probably damaging 1.00
IGL03134:Myo7a UTSW 7 98056767 missense probably damaging 0.96
PIT4696001:Myo7a UTSW 7 98063599 missense probably benign 0.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0054:Myo7a UTSW 7 98065698 missense probably damaging 1.00
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0071:Myo7a UTSW 7 98056830 missense probably damaging 0.98
R0267:Myo7a UTSW 7 98054624 missense probably benign 0.08
R0408:Myo7a UTSW 7 98056781 missense probably damaging 1.00
R0411:Myo7a UTSW 7 98071937 missense probably benign 0.00
R0540:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0607:Myo7a UTSW 7 98071946 missense probably damaging 1.00
R0629:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R0632:Myo7a UTSW 7 98112150 intron probably benign
R0659:Myo7a UTSW 7 98054338 splice site probably benign
R0735:Myo7a UTSW 7 98081180 splice site probably benign
R0924:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R0930:Myo7a UTSW 7 98098256 missense probably damaging 0.99
R1018:Myo7a UTSW 7 98107005 missense probably damaging 1.00
R1196:Myo7a UTSW 7 98097673 missense possibly damaging 0.87
R1331:Myo7a UTSW 7 98107008 missense probably benign 0.00
R1487:Myo7a UTSW 7 98053810 critical splice donor site probably null
R1676:Myo7a UTSW 7 98099472 critical splice donor site probably null
R1695:Myo7a UTSW 7 98092496 missense possibly damaging 0.94
R1770:Myo7a UTSW 7 98112606 intron probably benign
R1781:Myo7a UTSW 7 98073124 missense probably damaging 1.00
R1789:Myo7a UTSW 7 98107095 missense probably damaging 0.99
R1827:Myo7a UTSW 7 98076731 missense probably damaging 0.99
R1864:Myo7a UTSW 7 98052256 missense probably damaging 1.00
R1955:Myo7a UTSW 7 98054921 missense probably damaging 1.00
R2011:Myo7a UTSW 7 98054708 missense possibly damaging 0.69
R2229:Myo7a UTSW 7 98054910 missense probably benign 0.12
R2259:Myo7a UTSW 7 98069499 missense probably damaging 1.00
R2443:Myo7a UTSW 7 98095769 missense probably benign 0.07
R2898:Myo7a UTSW 7 98054424 nonsense probably null
R2898:Myo7a UTSW 7 98097206 missense probably damaging 1.00
R3158:Myo7a UTSW 7 98052292 missense probably damaging 1.00
R3408:Myo7a UTSW 7 98081087 missense probably benign 0.00
R4222:Myo7a UTSW 7 98073229 missense possibly damaging 0.93
R4255:Myo7a UTSW 7 98071964 missense probably damaging 0.96
R4374:Myo7a UTSW 7 98102674 missense probably damaging 1.00
R4429:Myo7a UTSW 7 98053188 missense probably damaging 0.99
R4445:Myo7a UTSW 7 98066404 missense probably damaging 1.00
R4579:Myo7a UTSW 7 98073193 missense probably damaging 1.00
R4659:Myo7a UTSW 7 98085466 missense probably damaging 1.00
R5073:Myo7a UTSW 7 98073218 nonsense probably null
R5138:Myo7a UTSW 7 98083599 missense probably damaging 1.00
R5566:Myo7a UTSW 7 98064816 missense possibly damaging 0.93
R5580:Myo7a UTSW 7 98073160 missense probably damaging 1.00
R6079:Myo7a UTSW 7 98065790 nonsense probably null
R6138:Myo7a UTSW 7 98065790 nonsense probably null
R6451:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6452:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6453:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6454:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6455:Myo7a UTSW 7 98073167 missense probably benign 0.01
R6465:Myo7a UTSW 7 98062680 missense possibly damaging 0.95
R6653:Myo7a UTSW 7 98054503 missense probably damaging 0.96
R6709:Myo7a UTSW 7 98054699 missense probably damaging 1.00
R6917:Myo7a UTSW 7 98095763 missense possibly damaging 0.58
R7313:Myo7a UTSW 7 98064195 missense probably damaging 0.99
R7334:Myo7a UTSW 7 98079366 missense probably benign
R7356:Myo7a UTSW 7 98102683 missense probably benign 0.01
R7393:Myo7a UTSW 7 98063699 missense possibly damaging 0.91
R7422:Myo7a UTSW 7 98051626 splice site probably null
R7472:Myo7a UTSW 7 98064793 missense probably damaging 1.00
R7483:Myo7a UTSW 7 98063674 missense probably benign 0.07
R7526:Myo7a UTSW 7 98085448 missense possibly damaging 0.49
R8069:Myo7a UTSW 7 98083626 nonsense probably null
RF005:Myo7a UTSW 7 98093617 missense probably benign 0.42
U15987:Myo7a UTSW 7 98065790 nonsense probably null
X0028:Myo7a UTSW 7 98065725 missense probably damaging 1.00
X0058:Myo7a UTSW 7 98062648 missense probably benign 0.02
Z1176:Myo7a UTSW 7 98095727 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98052226 missense probably damaging 0.98
Z1177:Myo7a UTSW 7 98085523 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CACATTTCCAGGTAAGGCATAGAG -3'
(R):5'- ATGATGCTATCTGCTCCCCG -3'

Sequencing Primer
(F):5'- TTTCCAGGTAAGGCATAGAGGGATG -3'
(R):5'- CGTGGGAAGCCTAGCAGGTG -3'
Posted On2020-01-23