Incidental Mutation 'R7948:Olfr33'
ID615974
Institutional Source Beutler Lab
Gene Symbol Olfr33
Ensembl Gene ENSMUSG00000066273
Gene Nameolfactory receptor 33
SynonymsMTPCR33, GA_x6K02T2PBJ9-5431102-5430146, MOR11-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7948 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102712151-102719070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102713688 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 242 (V242I)
Ref Sequence ENSEMBL: ENSMUSP00000149588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084817] [ENSMUST00000094124] [ENSMUST00000216312]
Predicted Effect probably benign
Transcript: ENSMUST00000084817
AA Change: V242I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081877
Gene: ENSMUSG00000066273
AA Change: V242I

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 2.1e-117 PFAM
Pfam:7TM_GPCR_Srsx 41 211 7.5e-11 PFAM
Pfam:7tm_1 47 299 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094124
SMART Domains Protein: ENSMUSP00000091674
Gene: ENSMUSG00000070423

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 6.2e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 2.4e-7 PFAM
Pfam:7tm_1 43 293 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216312
AA Change: V242I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik CGGTCTAGCTGAGCAGGAGGCAGCTCAGG CGG 14: 70,157,366 probably null Het
Abca8a A T 11: 110,050,979 Y1155N probably benign Het
Adcy8 C T 15: 64,815,350 R435K possibly damaging Het
Adgrv1 C A 13: 81,559,529 V1253F probably damaging Het
Adgrv1 T C 13: 81,559,588 D1233G probably damaging Het
Baz2a G A 10: 128,125,325 R1639H possibly damaging Het
Ccdc125 A G 13: 100,696,402 T496A probably benign Het
Cntnap5a A G 1: 116,580,528 M1257V probably benign Het
Cpne3 A G 4: 19,528,186 probably null Het
Cts3 T C 13: 61,566,049 E288G probably benign Het
Deup1 T C 9: 15,610,648 K74E possibly damaging Het
Epn1 T A 7: 5,089,993 Y101* probably null Het
Ercc4 A G 16: 13,130,185 D422G probably benign Het
Exoc6 A C 19: 37,576,974 N166T probably benign Het
Fam89a T C 8: 124,751,670 Y47C probably damaging Het
Fbn1 C A 2: 125,341,299 Q1753H probably damaging Het
Gal3st4 C T 5: 138,271,000 R66Q probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Golm1 C A 13: 59,664,197 probably null Het
Gtpbp3 A G 8: 71,492,586 H434R probably damaging Het
Hbegf A G 18: 36,506,699 L194S possibly damaging Het
Igsf10 A G 3: 59,331,858 S301P probably benign Het
Il9r A C 11: 32,194,486 C106W probably damaging Het
Lama5 T C 2: 180,202,201 D389G probably damaging Het
Lyst T A 13: 13,746,589 D3373E possibly damaging Het
Mkrn1 T A 6: 39,400,410 Y361F probably benign Het
Muc16 A T 9: 18,642,490 I4169N unknown Het
Myo7a C T 7: 98,075,029 G1150S probably damaging Het
Myom2 A G 8: 15,085,306 D503G probably benign Het
Nmnat3 A G 9: 98,399,482 I46V probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nrros A T 16: 32,162,258 N17K unknown Het
Patj A T 4: 98,424,310 K295M probably damaging Het
Pax6 A G 2: 105,685,877 T167A probably benign Het
Pclo T A 5: 14,765,166 L1212* probably null Het
Peg3 T A 7: 6,708,782 Y1147F probably damaging Het
Ppp2r5c T A 12: 110,465,986 N77K probably benign Het
Prickle2 T C 6: 92,416,922 I257V possibly damaging Het
Ptprc G A 1: 138,064,576 T1132I probably benign Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Skiv2l2 C T 13: 112,921,762 R45Q probably benign Het
Slc6a15 T A 10: 103,404,295 M293K possibly damaging Het
Tmem131 A T 1: 36,794,148 W1749R probably damaging Het
Trpm8 T A 1: 88,374,369 Y1020* probably null Het
Ttn G T 2: 76,768,179 Y19463* probably null Het
Tubgcp5 T A 7: 55,794,248 D18E probably benign Het
Ubtd1 T A 19: 42,033,735 F149I probably benign Het
Xirp2 A G 2: 67,519,314 K3279R possibly damaging Het
Zfp236 T C 18: 82,624,415 T1117A probably damaging Het
Zfp945 A T 17: 22,852,122 C289S unknown Het
Other mutations in Olfr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Olfr33 APN 7 102713601 missense probably damaging 1.00
IGL02349:Olfr33 APN 7 102714126 missense probably damaging 0.99
IGL02739:Olfr33 APN 7 102714314 missense possibly damaging 0.58
IGL03110:Olfr33 APN 7 102713883 missense probably damaging 1.00
IGL03014:Olfr33 UTSW 7 102713546 missense probably null 0.91
R0158:Olfr33 UTSW 7 102713955 missense probably benign 0.03
R1455:Olfr33 UTSW 7 102713998 nonsense probably null
R1996:Olfr33 UTSW 7 102713792 missense probably damaging 1.00
R2032:Olfr33 UTSW 7 102713876 missense probably benign 0.00
R2152:Olfr33 UTSW 7 102713581 missense probably benign 0.01
R4852:Olfr33 UTSW 7 102713543 missense probably damaging 0.99
R4965:Olfr33 UTSW 7 102713495 missense probably damaging 1.00
R5264:Olfr33 UTSW 7 102714351 missense probably benign 0.00
R5464:Olfr33 UTSW 7 102713682 missense probably benign
R6680:Olfr33 UTSW 7 102714315 missense possibly damaging 0.70
R7195:Olfr33 UTSW 7 102713666 missense possibly damaging 0.74
R7373:Olfr33 UTSW 7 102714099 missense possibly damaging 0.53
R7391:Olfr33 UTSW 7 102713982 missense probably benign 0.02
R7872:Olfr33 UTSW 7 102714182 missense probably benign 0.01
R8097:Olfr33 UTSW 7 102713990 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TAGCACTCTGAACATGGCTCC -3'
(R):5'- GCAAGATCCTCCTGTCTCAC -3'

Sequencing Primer
(F):5'- TGAACATGGCTCCCCTGATG -3'
(R):5'- ACTCATTCTGTTTCCATGCTGATG -3'
Posted On2020-01-23