Incidental Mutation 'R7948:Slc6a15'
ID 615981
Institutional Source Beutler Lab
Gene Symbol Slc6a15
Ensembl Gene ENSMUSG00000019894
Gene Name solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms v7-3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7948 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 103367783-103419377 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 103404295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 293 (M293K)
Ref Sequence ENSEMBL: ENSMUSP00000073829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074204] [ENSMUST00000179636]
AlphaFold Q8BG16
Predicted Effect possibly damaging
Transcript: ENSMUST00000074204
AA Change: M293K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073829
Gene: ENSMUSG00000019894
AA Change: M293K

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179636
AA Change: M293K

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136676
Gene: ENSMUSG00000019894
AA Change: M293K

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:SNF 61 644 2.2e-229 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the solute carrier family 6 protein family which transports neutral amino acids. The encoded protein is thought to play a role in neuronal amino acid transport (PMID: 16185194) and may be associated with major depression (PMID: 21521612). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased synaptosome transport activities but exhibit no behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik CGGTCTAGCTGAGCAGGAGGCAGCTCAGG CGG 14: 70,157,366 probably null Het
Abca8a A T 11: 110,050,979 Y1155N probably benign Het
Adcy8 C T 15: 64,815,350 R435K possibly damaging Het
Adgrv1 C A 13: 81,559,529 V1253F probably damaging Het
Adgrv1 T C 13: 81,559,588 D1233G probably damaging Het
Baz2a G A 10: 128,125,325 R1639H possibly damaging Het
Ccdc125 A G 13: 100,696,402 T496A probably benign Het
Cntnap5a A G 1: 116,580,528 M1257V probably benign Het
Cpne3 A G 4: 19,528,186 probably null Het
Cts3 T C 13: 61,566,049 E288G probably benign Het
Deup1 T C 9: 15,610,648 K74E possibly damaging Het
Epn1 T A 7: 5,089,993 Y101* probably null Het
Ercc4 A G 16: 13,130,185 D422G probably benign Het
Exoc6 A C 19: 37,576,974 N166T probably benign Het
Fam89a T C 8: 124,751,670 Y47C probably damaging Het
Fbn1 C A 2: 125,341,299 Q1753H probably damaging Het
Gal3st4 C T 5: 138,271,000 R66Q probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Golm1 C A 13: 59,664,197 probably null Het
Gtpbp3 A G 8: 71,492,586 H434R probably damaging Het
Hbegf A G 18: 36,506,699 L194S possibly damaging Het
Igsf10 A G 3: 59,331,858 S301P probably benign Het
Il9r A C 11: 32,194,486 C106W probably damaging Het
Lama5 T C 2: 180,202,201 D389G probably damaging Het
Lyst T A 13: 13,746,589 D3373E possibly damaging Het
Mkrn1 T A 6: 39,400,410 Y361F probably benign Het
Muc16 A T 9: 18,642,490 I4169N unknown Het
Myo7a C T 7: 98,075,029 G1150S probably damaging Het
Myom2 A G 8: 15,085,306 D503G probably benign Het
Nmnat3 A G 9: 98,399,482 I46V probably benign Het
Nrp2 C T 1: 62,745,408 R239C probably damaging Het
Nrros A T 16: 32,162,258 N17K unknown Het
Olfr33 C T 7: 102,713,688 V242I probably benign Het
Patj A T 4: 98,424,310 K295M probably damaging Het
Pax6 A G 2: 105,685,877 T167A probably benign Het
Pclo T A 5: 14,765,166 L1212* probably null Het
Peg3 T A 7: 6,708,782 Y1147F probably damaging Het
Ppp2r5c T A 12: 110,465,986 N77K probably benign Het
Prickle2 T C 6: 92,416,922 I257V possibly damaging Het
Ptprc G A 1: 138,064,576 T1132I probably benign Het
Serpinb6a G A 13: 33,923,020 S183L probably benign Het
Skiv2l2 C T 13: 112,921,762 R45Q probably benign Het
Tmem131 A T 1: 36,794,148 W1749R probably damaging Het
Trpm8 T A 1: 88,374,369 Y1020* probably null Het
Ttn G T 2: 76,768,179 Y19463* probably null Het
Tubgcp5 T A 7: 55,794,248 D18E probably benign Het
Ubtd1 T A 19: 42,033,735 F149I probably benign Het
Xirp2 A G 2: 67,519,314 K3279R possibly damaging Het
Zfp236 T C 18: 82,624,415 T1117A probably damaging Het
Zfp945 A T 17: 22,852,122 C289S unknown Het
Other mutations in Slc6a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc6a15 APN 10 103389141 missense probably benign
IGL01320:Slc6a15 APN 10 103404745 missense probably benign 0.00
IGL01924:Slc6a15 APN 10 103404825 splice site probably null
IGL02066:Slc6a15 APN 10 103416658 missense probably damaging 0.98
IGL02164:Slc6a15 APN 10 103418222 missense probably benign 0.01
IGL02551:Slc6a15 APN 10 103404275 splice site probably benign
IGL02744:Slc6a15 APN 10 103418033 missense probably benign 0.03
R0028:Slc6a15 UTSW 10 103416680 missense probably benign 0.00
R0143:Slc6a15 UTSW 10 103418068 missense probably benign 0.02
R0158:Slc6a15 UTSW 10 103389347 splice site probably benign
R0165:Slc6a15 UTSW 10 103409809 missense probably null 0.04
R0349:Slc6a15 UTSW 10 103418225 missense probably benign 0.06
R0383:Slc6a15 UTSW 10 103418053 missense probably damaging 1.00
R0614:Slc6a15 UTSW 10 103404352 nonsense probably null
R0784:Slc6a15 UTSW 10 103416800 splice site probably benign
R0944:Slc6a15 UTSW 10 103409796 missense probably benign 0.01
R1795:Slc6a15 UTSW 10 103400260 missense probably benign
R1882:Slc6a15 UTSW 10 103395064 missense probably benign 0.20
R2061:Slc6a15 UTSW 10 103409734 missense probably benign 0.20
R2156:Slc6a15 UTSW 10 103393408 missense probably damaging 1.00
R2358:Slc6a15 UTSW 10 103416785 missense probably benign 0.00
R2849:Slc6a15 UTSW 10 103404691 missense probably benign 0.01
R2921:Slc6a15 UTSW 10 103418387 missense probably damaging 0.99
R3709:Slc6a15 UTSW 10 103393414 missense probably benign 0.00
R4532:Slc6a15 UTSW 10 103409787 missense possibly damaging 0.69
R4825:Slc6a15 UTSW 10 103418060 missense probably benign 0.05
R4909:Slc6a15 UTSW 10 103404414 missense probably damaging 1.00
R5112:Slc6a15 UTSW 10 103389226 missense probably benign
R5320:Slc6a15 UTSW 10 103408206 missense probably damaging 1.00
R5364:Slc6a15 UTSW 10 103393508 missense probably damaging 0.99
R6305:Slc6a15 UTSW 10 103389170 missense probably benign 0.31
R6348:Slc6a15 UTSW 10 103404367 missense probably damaging 1.00
R6729:Slc6a15 UTSW 10 103393914 missense probably damaging 0.99
R6781:Slc6a15 UTSW 10 103395067 missense probably damaging 0.99
R7409:Slc6a15 UTSW 10 103408302 missense probably benign
R7549:Slc6a15 UTSW 10 103389137 missense probably benign
R7660:Slc6a15 UTSW 10 103393380 splice site probably null
R7839:Slc6a15 UTSW 10 103404799 missense probably benign
R8278:Slc6a15 UTSW 10 103394029 critical splice donor site probably null
R8379:Slc6a15 UTSW 10 103389187 missense probably benign 0.00
R8685:Slc6a15 UTSW 10 103409695 missense possibly damaging 0.68
R8712:Slc6a15 UTSW 10 103389251 missense probably damaging 1.00
R8719:Slc6a15 UTSW 10 103404315 missense probably damaging 0.99
R8832:Slc6a15 UTSW 10 103389318 missense probably damaging 1.00
R8940:Slc6a15 UTSW 10 103393496 missense probably damaging 1.00
R8978:Slc6a15 UTSW 10 103395092 nonsense probably null
R9050:Slc6a15 UTSW 10 103416655 missense possibly damaging 0.88
R9113:Slc6a15 UTSW 10 103400279 missense probably damaging 1.00
R9242:Slc6a15 UTSW 10 103393545 nonsense probably null
R9493:Slc6a15 UTSW 10 103393416 missense probably benign 0.35
R9529:Slc6a15 UTSW 10 103404722 missense probably benign 0.14
R9532:Slc6a15 UTSW 10 103404472 missense probably damaging 0.98
RF013:Slc6a15 UTSW 10 103400216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTGCATTCTTAGGTGC -3'
(R):5'- TACGATATTGGCTTTGAACCCC -3'

Sequencing Primer
(F):5'- TGCATTCTTAGGTGCTTTCCTAG -3'
(R):5'- ATTGGCTTTGAACCCCAGAACTG -3'
Posted On 2020-01-23