Incidental Mutation 'R7948:Golm1'
ID 615988
Institutional Source Beutler Lab
Gene Symbol Golm1
Ensembl Gene ENSMUSG00000021556
Gene Name golgi membrane protein 1
Synonyms Golph2, 2310001L02Rik, D030064E01Rik, PSEC0257, GP73
MMRRC Submission 045993-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7948 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 59782810-59823598 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 59812011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022039] [ENSMUST00000095739]
AlphaFold Q91XA2
Predicted Effect probably null
Transcript: ENSMUST00000022039
SMART Domains Protein: ENSMUSP00000022039
Gene: ENSMUSG00000021556

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095739
SMART Domains Protein: ENSMUSP00000093410
Gene: ENSMUSG00000021556

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 40 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased premature lethality with kidney abnormalities and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik CGGTCTAGCTGAGCAGGAGGCAGCTCAGG CGG 14: 70,394,815 (GRCm39) probably null Het
Abca8a A T 11: 109,941,805 (GRCm39) Y1155N probably benign Het
Adcy8 C T 15: 64,687,199 (GRCm39) R435K possibly damaging Het
Adgrv1 C A 13: 81,707,648 (GRCm39) V1253F probably damaging Het
Adgrv1 T C 13: 81,707,707 (GRCm39) D1233G probably damaging Het
Baz2a G A 10: 127,961,194 (GRCm39) R1639H possibly damaging Het
Ccdc125 A G 13: 100,832,910 (GRCm39) T496A probably benign Het
Cntnap5a A G 1: 116,508,258 (GRCm39) M1257V probably benign Het
Cpne3 A G 4: 19,528,186 (GRCm39) probably null Het
Cts3 T C 13: 61,713,863 (GRCm39) E288G probably benign Het
Deup1 T C 9: 15,521,944 (GRCm39) K74E possibly damaging Het
Epn1 T A 7: 5,092,992 (GRCm39) Y101* probably null Het
Ercc4 A G 16: 12,948,049 (GRCm39) D422G probably benign Het
Exoc6 A C 19: 37,565,422 (GRCm39) N166T probably benign Het
Fam89a T C 8: 125,478,409 (GRCm39) Y47C probably damaging Het
Fbn1 C A 2: 125,183,219 (GRCm39) Q1753H probably damaging Het
Gal3st4 C T 5: 138,269,262 (GRCm39) R66Q probably benign Het
Gatad1 T C 5: 3,693,540 (GRCm39) R210G probably benign Het
Gtpbp3 A G 8: 71,945,230 (GRCm39) H434R probably damaging Het
Hbegf A G 18: 36,639,752 (GRCm39) L194S possibly damaging Het
Igsf10 A G 3: 59,239,279 (GRCm39) S301P probably benign Het
Il9r A C 11: 32,144,486 (GRCm39) C106W probably damaging Het
Lama5 T C 2: 179,843,994 (GRCm39) D389G probably damaging Het
Lyst T A 13: 13,921,174 (GRCm39) D3373E possibly damaging Het
Mkrn1 T A 6: 39,377,344 (GRCm39) Y361F probably benign Het
Mtrex C T 13: 113,058,296 (GRCm39) R45Q probably benign Het
Muc16 A T 9: 18,553,786 (GRCm39) I4169N unknown Het
Myo7a C T 7: 97,724,236 (GRCm39) G1150S probably damaging Het
Myom2 A G 8: 15,135,306 (GRCm39) D503G probably benign Het
Nmnat3 A G 9: 98,281,535 (GRCm39) I46V probably benign Het
Nrp2 C T 1: 62,784,567 (GRCm39) R239C probably damaging Het
Nrros A T 16: 31,981,076 (GRCm39) N17K unknown Het
Or51a39 C T 7: 102,362,895 (GRCm39) V242I probably benign Het
Patj A T 4: 98,312,547 (GRCm39) K295M probably damaging Het
Pax6 A G 2: 105,516,222 (GRCm39) T167A probably benign Het
Pclo T A 5: 14,815,180 (GRCm39) L1212* probably null Het
Peg3 T A 7: 6,711,781 (GRCm39) Y1147F probably damaging Het
Ppp2r5c T A 12: 110,432,420 (GRCm39) N77K probably benign Het
Prickle2 T C 6: 92,393,903 (GRCm39) I257V possibly damaging Het
Ptprc G A 1: 137,992,314 (GRCm39) T1132I probably benign Het
Serpinb6a G A 13: 34,107,003 (GRCm39) S183L probably benign Het
Slc6a15 T A 10: 103,240,156 (GRCm39) M293K possibly damaging Het
Tmem131 A T 1: 36,833,229 (GRCm39) W1749R probably damaging Het
Trpm8 T A 1: 88,302,091 (GRCm39) Y1020* probably null Het
Ttn G T 2: 76,598,523 (GRCm39) Y19463* probably null Het
Tubgcp5 T A 7: 55,443,996 (GRCm39) D18E probably benign Het
Ubtd1 T A 19: 42,022,174 (GRCm39) F149I probably benign Het
Xirp2 A G 2: 67,349,658 (GRCm39) K3279R possibly damaging Het
Zfp236 T C 18: 82,642,540 (GRCm39) T1117A probably damaging Het
Zfp945 A T 17: 23,071,096 (GRCm39) C289S unknown Het
Other mutations in Golm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Golm1 APN 13 59,797,470 (GRCm39) missense probably damaging 0.99
IGL01327:Golm1 APN 13 59,792,958 (GRCm39) missense possibly damaging 0.95
IGL02348:Golm1 APN 13 59,786,191 (GRCm39) missense probably benign 0.00
R0047:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign 0.03
R0047:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign 0.03
R0458:Golm1 UTSW 13 59,812,178 (GRCm39) missense probably damaging 0.98
R0989:Golm1 UTSW 13 59,787,997 (GRCm39) missense probably benign 0.01
R1301:Golm1 UTSW 13 59,786,187 (GRCm39) missense probably damaging 0.99
R1804:Golm1 UTSW 13 59,790,203 (GRCm39) critical splice acceptor site probably null
R1905:Golm1 UTSW 13 59,790,065 (GRCm39) missense probably benign 0.04
R1940:Golm1 UTSW 13 59,790,051 (GRCm39) splice site probably benign
R2086:Golm1 UTSW 13 59,792,999 (GRCm39) nonsense probably null
R2513:Golm1 UTSW 13 59,790,072 (GRCm39) missense probably benign 0.01
R2887:Golm1 UTSW 13 59,788,044 (GRCm39) missense probably benign 0.00
R3903:Golm1 UTSW 13 59,786,154 (GRCm39) missense probably damaging 1.00
R4154:Golm1 UTSW 13 59,790,167 (GRCm39) missense probably benign 0.01
R5580:Golm1 UTSW 13 59,790,179 (GRCm39) missense probably benign 0.03
R6193:Golm1 UTSW 13 59,792,972 (GRCm39) missense probably benign 0.00
R6418:Golm1 UTSW 13 59,813,375 (GRCm39) missense probably damaging 1.00
R6594:Golm1 UTSW 13 59,812,041 (GRCm39) missense possibly damaging 0.79
R6604:Golm1 UTSW 13 59,786,197 (GRCm39) missense probably damaging 1.00
R6967:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6968:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6991:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6992:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6993:Golm1 UTSW 13 59,797,390 (GRCm39) small deletion probably benign
R6996:Golm1 UTSW 13 59,790,058 (GRCm39) missense probably benign 0.00
R7576:Golm1 UTSW 13 59,792,920 (GRCm39) missense probably benign 0.00
R7692:Golm1 UTSW 13 59,788,071 (GRCm39) missense probably benign 0.08
R7863:Golm1 UTSW 13 59,797,383 (GRCm39) missense probably damaging 1.00
R9519:Golm1 UTSW 13 59,792,914 (GRCm39) missense probably benign
R9703:Golm1 UTSW 13 59,797,433 (GRCm39) missense probably benign 0.39
X0026:Golm1 UTSW 13 59,786,127 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAAATTCTGCAGTCACTGAAC -3'
(R):5'- ATTGTAGAGCTGGAAGGCCG -3'

Sequencing Primer
(F):5'- ATTGAGTCACGGTTCAAGCC -3'
(R):5'- CTGGAAGGCCGGGTCCG -3'
Posted On 2020-01-23