Incidental Mutation 'R7995:Capn2'
ID616005
Institutional Source Beutler Lab
Gene Symbol Capn2
Ensembl Gene ENSMUSG00000026509
Gene Namecalpain 2
SynonymsCapa-2, Capa2, m-calpain
Accession Numbers

Genbank: NM_009794 ; MGI: 88264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182467260-182517608 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 182478546 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068505]
Predicted Effect probably null
Transcript: ENSMUST00000068505
SMART Domains Protein: ENSMUSP00000068895
Gene: ENSMUSG00000026509

DomainStartEndE-ValueType
CysPc 27 352 1.62e-186 SMART
calpain_III 355 510 3.47e-90 SMART
low complexity region 513 532 N/A INTRINSIC
EFh 576 604 5.86e0 SMART
EFh 606 634 3.21e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Mice homozygous for one null allele display placental dysfunction, thin ventricular walls, and peripheral vessel failure. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Capn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Capn2 APN 1 182473954 splice site probably benign
IGL02589:Capn2 APN 1 182484348 missense probably damaging 1.00
IGL02679:Capn2 APN 1 182472584 missense probably benign
IGL03207:Capn2 APN 1 182489013 missense possibly damaging 0.92
E7848:Capn2 UTSW 1 182486594 missense possibly damaging 0.67
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0540:Capn2 UTSW 1 182492184 nonsense probably null
R0571:Capn2 UTSW 1 182470760 missense probably benign 0.01
R1620:Capn2 UTSW 1 182517137 missense probably damaging 1.00
R1818:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1819:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1822:Capn2 UTSW 1 182472960 missense possibly damaging 0.95
R1880:Capn2 UTSW 1 182489016 missense probably damaging 1.00
R2174:Capn2 UTSW 1 182479725 missense probably benign 0.22
R2391:Capn2 UTSW 1 182478609 missense probably benign 0.01
R2860:Capn2 UTSW 1 182472920 splice site probably benign
R2861:Capn2 UTSW 1 182472920 splice site probably benign
R2878:Capn2 UTSW 1 182517233 missense probably benign 0.00
R3052:Capn2 UTSW 1 182487772 missense probably benign 0.06
R4463:Capn2 UTSW 1 182479764 intron probably benign
R4669:Capn2 UTSW 1 182470780 missense probably benign 0.00
R5077:Capn2 UTSW 1 182472573 missense possibly damaging 0.71
R5397:Capn2 UTSW 1 182470706 missense probably damaging 1.00
R5696:Capn2 UTSW 1 182478600 missense possibly damaging 0.79
R6777:Capn2 UTSW 1 182470177 critical splice donor site probably null
R6800:Capn2 UTSW 1 182481480 missense probably damaging 0.99
R7741:Capn2 UTSW 1 182479723 nonsense probably null
R7814:Capn2 UTSW 1 182492146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTATGGAGAGGGCTGCC -3'
(R):5'- GTAAGGCCAGTATCCTAAGAACTC -3'

Sequencing Primer
(F):5'- TGCCCCAGAAGTCAGCAGAG -3'
(R):5'- AGATTGACGCCAATGAGG -3'
Posted On2020-01-23