Incidental Mutation 'R7995:Ube2j2'
ID616016
Institutional Source Beutler Lab
Gene Symbol Ube2j2
Ensembl Gene ENSMUSG00000023286
Gene Nameubiquitin-conjugating enzyme E2J 2
Synonyms1200007B18Rik, Ubc6, 5730472G04Rik, 2400008G19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155943831-155959604 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 155957338 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 263 (Y263*)
Ref Sequence ENSEMBL: ENSMUSP00000024056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024056] [ENSMUST00000024338] [ENSMUST00000103175] [ENSMUST00000105581] [ENSMUST00000105582] [ENSMUST00000105583] [ENSMUST00000118192] [ENSMUST00000152536] [ENSMUST00000166489]
Predicted Effect probably null
Transcript: ENSMUST00000024056
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000024056
Gene: ENSMUSG00000023286
AA Change: Y263*

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000024338
SMART Domains Protein: ENSMUSP00000024338
Gene: ENSMUSG00000023571

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 94 118 N/A INTRINSIC
Blast:TNF 168 305 1e-17 BLAST
SCOP:d1gr3a_ 192 306 2e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103175
AA Change: Y251*
SMART Domains Protein: ENSMUSP00000099464
Gene: ENSMUSG00000023286
AA Change: Y251*

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105581
AA Change: Y251*
SMART Domains Protein: ENSMUSP00000101206
Gene: ENSMUSG00000023286
AA Change: Y251*

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105582
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000101207
Gene: ENSMUSG00000023286
AA Change: Y263*

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105583
AA Change: Y263*
SMART Domains Protein: ENSMUSP00000101208
Gene: ENSMUSG00000023286
AA Change: Y263*

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000118192
AA Change: Y224*
SMART Domains Protein: ENSMUSP00000112785
Gene: ENSMUSG00000023286
AA Change: Y224*

DomainStartEndE-ValueType
UBCc 15 153 5.28e-27 SMART
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152536
SMART Domains Protein: ENSMUSP00000114235
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 2 117 5.4e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166489
AA Change: Y251*
SMART Domains Protein: ENSMUSP00000127712
Gene: ENSMUSG00000023286
AA Change: Y251*

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Ube2j2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ube2j2 APN 4 155956447 missense possibly damaging 0.79
IGL00951:Ube2j2 APN 4 155946377 intron probably benign
IGL00953:Ube2j2 APN 4 155946377 intron probably benign
IGL01732:Ube2j2 APN 4 155957331 missense probably damaging 1.00
IGL02709:Ube2j2 APN 4 155957331 missense probably damaging 1.00
R1903:Ube2j2 UTSW 4 155949026 missense probably benign 0.13
R4172:Ube2j2 UTSW 4 155949086 missense probably damaging 1.00
R4630:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4632:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4999:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5000:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5249:Ube2j2 UTSW 4 155949058 missense possibly damaging 0.85
R7225:Ube2j2 UTSW 4 155949316 intron probably null
R7436:Ube2j2 UTSW 4 155957331 missense probably damaging 1.00
R7688:Ube2j2 UTSW 4 155956428 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGCCAGACGTGGTTCCTG -3'
(R):5'- GTTGAGAACCACCAGTCTCCTC -3'

Sequencing Primer
(F):5'- TTCCTGATGGGGAGCTGCAC -3'
(R):5'- AGTCTCCTCCAGATCACATTTTGG -3'
Posted On2020-01-23