Incidental Mutation 'R7995:Rpusd4'
ID616034
Institutional Source Beutler Lab
Gene Symbol Rpusd4
Ensembl Gene ENSMUSG00000032044
Gene NameRNA pseudouridylate synthase domain containing 4
Synonyms2410001E19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35267865-35277731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35272721 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 224 (Y224C)
Ref Sequence ENSEMBL: ENSMUSP00000034543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034543] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087] [ENSMUST00000217306]
Predicted Effect probably damaging
Transcript: ENSMUST00000034543
AA Change: Y224C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034543
Gene: ENSMUSG00000032044
AA Change: Y224C

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 105 277 5.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125087
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144582
Predicted Effect probably benign
Transcript: ENSMUST00000217306
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Rpusd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Rpusd4 APN 9 35268442 missense probably benign 0.34
IGL00722:Rpusd4 APN 9 35268418 missense possibly damaging 0.66
IGL01657:Rpusd4 APN 9 35273461 unclassified probably benign
IGL01780:Rpusd4 APN 9 35268424 missense probably damaging 0.98
IGL03290:Rpusd4 APN 9 35267977 missense probably benign
R0607:Rpusd4 UTSW 9 35267993 missense possibly damaging 0.93
R1081:Rpusd4 UTSW 9 35275088 missense probably benign 0.04
R1441:Rpusd4 UTSW 9 35272769 missense probably damaging 0.97
R2029:Rpusd4 UTSW 9 35268014 missense probably benign 0.00
R3929:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
R4107:Rpusd4 UTSW 9 35275128 missense probably damaging 1.00
R4840:Rpusd4 UTSW 9 35268535 missense probably damaging 1.00
R5429:Rpusd4 UTSW 9 35272602 missense probably benign 0.01
R5801:Rpusd4 UTSW 9 35270073 missense possibly damaging 0.83
R5988:Rpusd4 UTSW 9 35272520 splice site probably null
R6318:Rpusd4 UTSW 9 35268038 missense probably damaging 1.00
R7819:Rpusd4 UTSW 9 35267932 missense probably benign
R8227:Rpusd4 UTSW 9 35268535 missense probably benign 0.22
R8246:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
V1662:Rpusd4 UTSW 9 35272761 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACCTGGCTTTTGTGGCTCAAAC -3'
(R):5'- AGGATCTAGAACAAGGCCCG -3'

Sequencing Primer
(F):5'- AGCAGTCTGTGTGTCACCC -3'
(R):5'- CCGGGACAAACCATGGTG -3'
Posted On2020-01-23