Incidental Mutation 'R7995:Tspan3'
ID616036
Institutional Source Beutler Lab
Gene Symbol Tspan3
Ensembl Gene ENSMUSG00000032324
Gene Nametetraspanin 3
SynonymsTM4-A, tetraspanin, Tm4sf8, tetraspanin TM4-A homolog, Tspan-3, 1700055K04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location56131725-56165477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56147154 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 88 (F88I)
Ref Sequence ENSEMBL: ENSMUSP00000034876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034876] [ENSMUST00000215906] [ENSMUST00000216320]
Predicted Effect probably benign
Transcript: ENSMUST00000034876
AA Change: F88I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034876
Gene: ENSMUSG00000032324
AA Change: F88I

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 237 1.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215906
AA Change: F91I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216320
AA Change: F128I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hematopoietic stem cell number and decreased leukemia incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Tspan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02880:Tspan3 APN 9 56146516 missense possibly damaging 0.78
R0585:Tspan3 UTSW 9 56145932 splice site probably benign
R0608:Tspan3 UTSW 9 56147385 critical splice donor site probably null
R1067:Tspan3 UTSW 9 56160820 missense probably benign 0.01
R1368:Tspan3 UTSW 9 56147499 missense probably benign 0.08
R4673:Tspan3 UTSW 9 56136696 missense probably damaging 1.00
R6727:Tspan3 UTSW 9 56147440 missense probably damaging 1.00
R7701:Tspan3 UTSW 9 56147519 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCGTAGGTATATTAGAGCAGCAG -3'
(R):5'- TGTCAGACTATGGAGGGCTG -3'

Sequencing Primer
(F):5'- GTAAGACAATGGCAATGCTGACTTTG -3'
(R):5'- GACCTCTATCTTGAATGGAGAGC -3'
Posted On2020-01-23