Incidental Mutation 'R7995:Dnajc13'
ID 616037
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene Name DnaJ heat shock protein family (Hsp40) member C13
Synonyms LOC382100, D030002L11Rik, Rme8
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R7995 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104151282-104262930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104174363 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1765 (I1765N)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
AlphaFold D4AFX7
Predicted Effect probably damaging
Transcript: ENSMUST00000035170
AA Change: I1760N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: I1760N

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186788
AA Change: I1765N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: I1765N

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
impressario UTSW 9 104213886 missense probably benign 0.12
Kaiser UTSW 9 104214188 missense probably damaging 1.00
BB008:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
BB018:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
R7856:Dnajc13 UTSW 9 104167485 missense possibly damaging 0.83
R7931:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
R8319:Dnajc13 UTSW 9 104190391 missense probably benign 0.00
R8354:Dnajc13 UTSW 9 104217728 missense probably damaging 1.00
R8680:Dnajc13 UTSW 9 104180139 missense probably benign
R8686:Dnajc13 UTSW 9 104170805 missense probably benign 0.00
R8707:Dnajc13 UTSW 9 104192648 missense probably damaging 0.96
R8847:Dnajc13 UTSW 9 104180161 nonsense probably null
R8868:Dnajc13 UTSW 9 104165788 missense probably benign 0.13
R8986:Dnajc13 UTSW 9 104180131 missense probably damaging 1.00
R9139:Dnajc13 UTSW 9 104207840 missense probably benign 0.02
R9334:Dnajc13 UTSW 9 104174460 missense probably benign 0.00
R9353:Dnajc13 UTSW 9 104190372 missense probably benign 0.31
R9470:Dnajc13 UTSW 9 104230720 missense probably benign 0.01
R9528:Dnajc13 UTSW 9 104237705 missense probably benign
R9578:Dnajc13 UTSW 9 104238527 missense probably benign 0.04
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACTGTGTTGCAAAGAAGC -3'
(R):5'- GCTTAGGTTCCTAAAGAGTTTGC -3'

Sequencing Primer
(F):5'- TTCTAAACATGGCCCCCAGTG -3'
(R):5'- CCTAAAGAGTTTGCTGCAAGTCTG -3'
Posted On 2020-01-23