Incidental Mutation 'R7995:Tmem94'
ID616046
Institutional Source Beutler Lab
Gene Symbol Tmem94
Ensembl Gene ENSMUSG00000020747
Gene Nametransmembrane protein 94
Synonyms2310067B10Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location115765433-115799366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115797971 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1335 (E1335K)
Ref Sequence ENSEMBL: ENSMUSP00000091440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033]
Predicted Effect probably benign
Transcript: ENSMUST00000041684
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093912
AA Change: E1335K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747
AA Change: E1335K

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103033
AA Change: E1335K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747
AA Change: E1335K

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vcan T C 13: 89,691,858 T1856A probably benign Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Tmem94
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Tmem94 APN 11 115795328 missense probably damaging 0.99
IGL01086:Tmem94 APN 11 115790284 missense probably benign 0.25
IGL01314:Tmem94 APN 11 115790009 missense probably damaging 0.99
IGL02123:Tmem94 APN 11 115787538 missense possibly damaging 0.51
IGL02355:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02362:Tmem94 APN 11 115794745 missense probably damaging 1.00
IGL02366:Tmem94 APN 11 115797432 missense probably damaging 0.98
IGL02450:Tmem94 APN 11 115793071 missense probably damaging 1.00
IGL02623:Tmem94 APN 11 115796401 nonsense probably null
IGL02816:Tmem94 APN 11 115788704 unclassified probably null
IGL02836:Tmem94 APN 11 115792939 missense probably damaging 1.00
IGL03061:Tmem94 APN 11 115792421 missense possibly damaging 0.94
IGL03109:Tmem94 APN 11 115792398 missense probably damaging 1.00
IGL03255:Tmem94 APN 11 115792068 unclassified probably benign
IGL03397:Tmem94 APN 11 115787568 unclassified probably benign
capitulate UTSW 11 115796746 missense probably damaging 1.00
R0083:Tmem94 UTSW 11 115796724 unclassified probably benign
R0336:Tmem94 UTSW 11 115787385 missense probably benign
R0370:Tmem94 UTSW 11 115788717 missense probably damaging 1.00
R0494:Tmem94 UTSW 11 115794781 splice site probably null
R0638:Tmem94 UTSW 11 115792060 unclassified probably null
R0647:Tmem94 UTSW 11 115796795 missense probably damaging 1.00
R0900:Tmem94 UTSW 11 115791978 missense probably benign 0.00
R1469:Tmem94 UTSW 11 115795091 unclassified probably benign
R1616:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R1621:Tmem94 UTSW 11 115785845 missense probably benign
R1682:Tmem94 UTSW 11 115790230 missense probably damaging 1.00
R1723:Tmem94 UTSW 11 115794748 missense probably damaging 1.00
R1760:Tmem94 UTSW 11 115796754 missense probably damaging 1.00
R1826:Tmem94 UTSW 11 115793213 nonsense probably null
R1926:Tmem94 UTSW 11 115792900 missense possibly damaging 0.67
R1956:Tmem94 UTSW 11 115788674 missense possibly damaging 0.75
R2033:Tmem94 UTSW 11 115794328 missense possibly damaging 0.65
R2135:Tmem94 UTSW 11 115794749 missense probably benign
R2419:Tmem94 UTSW 11 115796815 missense probably damaging 1.00
R2511:Tmem94 UTSW 11 115791961 missense probably damaging 1.00
R3932:Tmem94 UTSW 11 115789254 missense probably benign 0.00
R4708:Tmem94 UTSW 11 115786295 missense possibly damaging 0.87
R4812:Tmem94 UTSW 11 115796112 nonsense probably null
R5026:Tmem94 UTSW 11 115793104 missense probably damaging 1.00
R5714:Tmem94 UTSW 11 115793190 missense probably benign 0.04
R5716:Tmem94 UTSW 11 115792428 missense probably benign 0.17
R6180:Tmem94 UTSW 11 115791031 critical splice acceptor site probably null
R6295:Tmem94 UTSW 11 115796746 missense probably damaging 1.00
R6594:Tmem94 UTSW 11 115798286 missense probably damaging 1.00
R6696:Tmem94 UTSW 11 115791988 missense probably damaging 1.00
R6883:Tmem94 UTSW 11 115796461 missense probably damaging 1.00
R6939:Tmem94 UTSW 11 115785830 missense possibly damaging 0.47
R7060:Tmem94 UTSW 11 115792938 missense probably damaging 1.00
R7171:Tmem94 UTSW 11 115790955 intron probably null
R7181:Tmem94 UTSW 11 115794774 missense probably damaging 0.97
R7290:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7292:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7345:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7346:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7378:Tmem94 UTSW 11 115794174 missense probably damaging 1.00
R7380:Tmem94 UTSW 11 115796145 critical splice donor site probably null
R7460:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7461:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7463:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7464:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7465:Tmem94 UTSW 11 115786256 missense possibly damaging 0.54
R7673:Tmem94 UTSW 11 115788378 missense probably benign 0.05
RF003:Tmem94 UTSW 11 115796132 missense probably damaging 1.00
X0024:Tmem94 UTSW 11 115786253 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- CCTTCAACTAGTCGGACTTGG -3'
(R):5'- ACACGGACCCTGGTGAAATAG -3'

Sequencing Primer
(F):5'- CTTCAACTAGTCGGACTTGGAAAGAG -3'
(R):5'- ACAGTTGACAACTTGGCCTG -3'
Posted On2020-01-23