Incidental Mutation 'R7995:Vcan'
ID616052
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7995 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89691858 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1856 (T1856A)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109546
AA Change: T1856A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: T1856A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
AA Change: T896A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614
AA Change: T896A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,879 T137S unknown Het
Apbb1 T C 7: 105,565,645 D462G probably benign Het
Arhgef1 T G 7: 24,919,216 L387R probably damaging Het
Ass1 A G 2: 31,486,540 I139V probably benign Het
B4galt5 A G 2: 167,301,376 V376A probably damaging Het
Bdkrb1 A G 12: 105,605,120 N315S probably damaging Het
Brap A T 5: 121,682,846 I429L probably benign Het
Capn2 A G 1: 182,478,546 probably null Het
Car10 A G 11: 93,597,122 Y215C probably damaging Het
Ccdc102a T C 8: 94,907,867 T365A probably damaging Het
Cdc42ep1 A G 15: 78,847,496 H47R probably damaging Het
Celsr3 G A 9: 108,845,083 S2734N probably damaging Het
Cers5 A C 15: 99,740,942 probably null Het
Cfap43 T C 19: 47,898,023 E51G probably damaging Het
Cftr T A 6: 18,214,156 D110E probably damaging Het
Cntnap5a A G 1: 116,571,547 K1176E probably damaging Het
Dlx6 A T 6: 6,867,277 R293S probably damaging Het
Dnah2 A T 11: 69,520,737 F353Y possibly damaging Het
Dnajc13 A T 9: 104,174,363 I1765N probably damaging Het
Ercc6 G T 14: 32,562,569 R763L probably damaging Het
Furin T C 7: 80,395,447 N243S probably damaging Het
Gm13083 A G 4: 143,616,000 I226V possibly damaging Het
Hace1 A G 10: 45,589,492 E48G probably damaging Het
Kcnv1 G A 15: 45,109,347 T380I probably damaging Het
Klk4 T A 7: 43,883,586 I32N probably damaging Het
Lexm T A 4: 106,615,915 H57L probably benign Het
Lingo2 T C 4: 35,709,425 E185G probably damaging Het
Lrba T A 3: 86,619,551 W2239R probably damaging Het
Micalcl T A 7: 112,381,768 D316E probably benign Het
Mlh1 G T 9: 111,235,921 N555K probably damaging Het
Mroh2b G A 15: 4,921,357 W579* probably null Het
Mycs G A X: 5,468,804 P74L probably damaging Het
Olfr486 A T 7: 108,172,000 L248H probably damaging Het
Olfr802 T C 10: 129,682,640 Y33C probably damaging Het
Pak2 T C 16: 32,027,772 I365V possibly damaging Het
Pcdhga11 C A 18: 37,757,025 S362* probably null Het
Pdk4 C T 6: 5,487,093 V318M probably benign Het
Phc2 C T 4: 128,709,608 T177M probably damaging Het
Phldb1 A T 9: 44,715,372 L592Q probably damaging Het
Pigr A G 1: 130,841,686 Y78C probably damaging Het
Pnkp T A 7: 44,858,536 Y94* probably null Het
Polr2b T C 5: 77,325,767 V310A possibly damaging Het
Prl7d1 T A 13: 27,710,071 I171L probably benign Het
Rpusd4 A G 9: 35,272,721 Y224C probably damaging Het
Scara5 C A 14: 65,759,608 R390S possibly damaging Het
Scin C T 12: 40,079,805 V330I probably benign Het
Sdr42e1 T A 8: 117,663,268 R211S probably benign Het
Slc36a3 C A 11: 55,129,669 A292S probably benign Het
Spata31d1a T C 13: 59,701,110 D1068G probably benign Het
Srd5a1 T A 13: 69,611,219 D10V probably damaging Het
Sspo G T 6: 48,492,889 C4507F probably damaging Het
Tmem94 G A 11: 115,797,971 E1335K probably damaging Het
Tnfrsf13b C T 11: 61,140,916 Q28* probably null Het
Tspan3 A T 9: 56,147,154 F88I probably benign Het
Ttn T C 2: 76,762,175 K20871R probably benign Het
Ube2j2 C A 4: 155,957,338 Y263* probably null Het
Vrk3 T C 7: 44,764,161 L218P probably damaging Het
Zfp236 G T 18: 82,639,336 H761N probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zfp827 T A 8: 79,118,258 S686T possibly damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1932:Vcan UTSW 13 89705534 missense possibly damaging 0.78
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
R7753:Vcan UTSW 13 89689323 missense probably damaging 1.00
R7762:Vcan UTSW 13 89692937 missense probably damaging 1.00
R7778:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7824:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7998:Vcan UTSW 13 89704327 missense probably damaging 1.00
R8033:Vcan UTSW 13 89704360 missense probably benign 0.04
R8061:Vcan UTSW 13 89657290 missense probably benign 0.45
R8103:Vcan UTSW 13 89657658 missense probably damaging 1.00
R8103:Vcan UTSW 13 89703320 nonsense probably null
R8124:Vcan UTSW 13 89704254 missense possibly damaging 0.93
R8162:Vcan UTSW 13 89704987 nonsense probably null
R8166:Vcan UTSW 13 89692736 missense probably benign 0.02
R8274:Vcan UTSW 13 89704970 missense probably benign 0.02
R8284:Vcan UTSW 13 89704335 missense possibly damaging 0.68
R8417:Vcan UTSW 13 89688743 missense probably benign 0.19
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Z1176:Vcan UTSW 13 89692571 missense probably benign 0.10
Z1177:Vcan UTSW 13 89703524 missense probably benign 0.00
Z1177:Vcan UTSW 13 89703788 nonsense probably null
Z1177:Vcan UTSW 13 89704073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTTGGATAAGACACTGTTGG -3'
(R):5'- ATCCCAGGGTTCAGGAAGAG -3'

Sequencing Primer
(F):5'- GTTGGATATTCACTGAAGTCACCAC -3'
(R):5'- GTTCAGGAAGAGCTGACCACTCTC -3'
Posted On2020-01-23