Mutagenetix > Incidental Mutations

Incidental Mutation 'R7995:Mroh2b'

616055

Institutional Source

Beutler Lab

Gene Symbol

Mroh2b

Ensembl Gene

ENSMUSG00000022155

Gene Name

maestro heat-like repeat family member 2B

Synonyms

4930455B06Rik, Heatr7b2

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.128) question?

Stock #

R7995 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4898737-4962205 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 4921357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 579 (W579*)

Ref Sequence

ENSEMBL: ENSMUSP00000036148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045736]

AlphaFold

Q7M6Y6

Predicted Effect

probably null
Transcript: ENSMUST00000045736
AA Change: W579*

SMART Domains

Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: W579*

Domain	Start	End	E-Value	Type
low complexity region	124	135	N/A	INTRINSIC
low complexity region	824	842	N/A	INTRINSIC
SCOP:d1gw5a_	937	1443	7e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	T	A	3: 124,556,879	T137S	unknown	Het
Apbb1	T	C	7: 105,565,645	D462G	probably benign	Het
Arhgef1	T	G	7: 24,919,216	L387R	probably damaging	Het
Ass1	A	G	2: 31,486,540	I139V	probably benign	Het
B4galt5	A	G	2: 167,301,376	V376A	probably damaging	Het
Bdkrb1	A	G	12: 105,605,120	N315S	probably damaging	Het
Brap	A	T	5: 121,682,846	I429L	probably benign	Het
Capn2	A	G	1: 182,478,546		probably null	Het
Car10	A	G	11: 93,597,122	Y215C	probably damaging	Het
Ccdc102a	T	C	8: 94,907,867	T365A	probably damaging	Het
Cdc42ep1	A	G	15: 78,847,496	H47R	probably damaging	Het
Celsr3	G	A	9: 108,845,083	S2734N	probably damaging	Het
Cers5	A	C	15: 99,740,942		probably null	Het
Cfap43	T	C	19: 47,898,023	E51G	probably damaging	Het
Cftr	T	A	6: 18,214,156	D110E	probably damaging	Het
Cntnap5a	A	G	1: 116,571,547	K1176E	probably damaging	Het
Dlx6	A	T	6: 6,867,277	R293S	probably damaging	Het
Dnah2	A	T	11: 69,520,737	F353Y	possibly damaging	Het
Dnajc13	A	T	9: 104,174,363	I1765N	probably damaging	Het
Ercc6	G	T	14: 32,562,569	R763L	probably damaging	Het
Furin	T	C	7: 80,395,447	N243S	probably damaging	Het
Gm13083	A	G	4: 143,616,000	I226V	possibly damaging	Het
Hace1	A	G	10: 45,589,492	E48G	probably damaging	Het
Kcnv1	G	A	15: 45,109,347	T380I	probably damaging	Het
Klk4	T	A	7: 43,883,586	I32N	probably damaging	Het
Lexm	T	A	4: 106,615,915	H57L	probably benign	Het
Lingo2	T	C	4: 35,709,425	E185G	probably damaging	Het
Lrba	T	A	3: 86,619,551	W2239R	probably damaging	Het
Micalcl	T	A	7: 112,381,768	D316E	probably benign	Het
Mlh1	G	T	9: 111,235,921	N555K	probably damaging	Het
Mycs	G	A	X: 5,468,804	P74L	probably damaging	Het
Olfr486	A	T	7: 108,172,000	L248H	probably damaging	Het
Olfr802	T	C	10: 129,682,640	Y33C	probably damaging	Het
Pak2	T	C	16: 32,027,772	I365V	possibly damaging	Het
Pcdhga11	C	A	18: 37,757,025	S362*	probably null	Het
Pdk4	C	T	6: 5,487,093	V318M	probably benign	Het
Phc2	C	T	4: 128,709,608	T177M	probably damaging	Het
Phldb1	A	T	9: 44,715,372	L592Q	probably damaging	Het
Pigr	A	G	1: 130,841,686	Y78C	probably damaging	Het
Pnkp	T	A	7: 44,858,536	Y94*	probably null	Het
Polr2b	T	C	5: 77,325,767	V310A	possibly damaging	Het
Prl7d1	T	A	13: 27,710,071	I171L	probably benign	Het
Rpusd4	A	G	9: 35,272,721	Y224C	probably damaging	Het
Scara5	C	A	14: 65,759,608	R390S	possibly damaging	Het
Scin	C	T	12: 40,079,805	V330I	probably benign	Het
Sdr42e1	T	A	8: 117,663,268	R211S	probably benign	Het
Slc36a3	C	A	11: 55,129,669	A292S	probably benign	Het
Spata31d1a	T	C	13: 59,701,110	D1068G	probably benign	Het
Srd5a1	T	A	13: 69,611,219	D10V	probably damaging	Het
Sspo	G	T	6: 48,492,889	C4507F	probably damaging	Het
Tmem94	G	A	11: 115,797,971	E1335K	probably damaging	Het
Tnfrsf13b	C	T	11: 61,140,916	Q28*	probably null	Het
Tspan3	A	T	9: 56,147,154	F88I	probably benign	Het
Ttn	T	C	2: 76,762,175	K20871R	probably benign	Het
Ube2j2	C	A	4: 155,957,338	Y263*	probably null	Het
Vcan	T	C	13: 89,691,858	T1856A	probably benign	Het
Vrk3	T	C	7: 44,764,161	L218P	probably damaging	Het
Zfp236	G	T	18: 82,639,336	H761N	probably damaging	Het
Zfp462	C	A	4: 55,011,907	A1291E	probably damaging	Het
Zfp827	T	A	8: 79,118,258	S686T	possibly damaging	Het

Other mutations in Mroh2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Mroh2b	APN	15	4899197	missense	probably benign
IGL00507:Mroh2b	APN	15	4962127	missense	probably damaging	1.00
IGL00548:Mroh2b	APN	15	4931316	missense	probably benign	0.35
IGL00902:Mroh2b	APN	15	4915222	missense	probably damaging	1.00
IGL00944:Mroh2b	APN	15	4951127	splice site	probably benign
IGL00954:Mroh2b	APN	15	4903054	missense	probably damaging	0.99
IGL01015:Mroh2b	APN	15	4941542	missense	probably damaging	1.00
IGL01134:Mroh2b	APN	15	4915152	missense	probably benign	0.00
IGL01337:Mroh2b	APN	15	4905024	missense	probably benign	0.38
IGL01780:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL01919:Mroh2b	APN	15	4923688	missense	probably benign	0.10
IGL02069:Mroh2b	APN	15	4904324	splice site	probably benign
IGL02146:Mroh2b	APN	15	4951294	splice site	probably null
IGL02221:Mroh2b	APN	15	4923641	missense	probably damaging	1.00
IGL02281:Mroh2b	APN	15	4952263	missense	probably benign	0.04
IGL02350:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02357:Mroh2b	APN	15	4912000	missense	probably benign	0.01
IGL02401:Mroh2b	APN	15	4900501	missense	possibly damaging	0.71
IGL02427:Mroh2b	APN	15	4951560	splice site	probably benign
IGL02432:Mroh2b	APN	15	4914186	missense	probably benign
IGL02582:Mroh2b	APN	15	4908515	missense	probably damaging	0.98
IGL02632:Mroh2b	APN	15	4931101	missense	probably damaging	0.99
IGL02741:Mroh2b	APN	15	4905632	missense	probably benign
IGL02811:Mroh2b	APN	15	4915236	missense	possibly damaging	0.55
IGL02826:Mroh2b	APN	15	4962148	missense	probably damaging	0.99
IGL03412:Mroh2b	APN	15	4944372	missense	probably benign	0.14
PIT4468001:Mroh2b	UTSW	15	4912812	missense	probably damaging	1.00
R0024:Mroh2b	UTSW	15	4925627	missense	probably damaging	1.00
R0333:Mroh2b	UTSW	15	4931118	missense	probably damaging	1.00
R0433:Mroh2b	UTSW	15	4941634	missense	probably benign	0.01
R0530:Mroh2b	UTSW	15	4934395	missense	probably damaging	0.97
R1411:Mroh2b	UTSW	15	4918317	missense	probably damaging	1.00
R1457:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1466:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1472:Mroh2b	UTSW	15	4948655	missense	probably benign	0.00
R1525:Mroh2b	UTSW	15	4951130	splice site	probably null
R1584:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R1605:Mroh2b	UTSW	15	4945090	missense	probably benign	0.08
R1657:Mroh2b	UTSW	15	4931043	nonsense	probably null
R1671:Mroh2b	UTSW	15	4951294	splice site	probably null
R1698:Mroh2b	UTSW	15	4914140	missense	probably benign	0.02
R2002:Mroh2b	UTSW	15	4925684	missense	probably damaging	1.00
R2005:Mroh2b	UTSW	15	4917158	missense	probably damaging	1.00
R2077:Mroh2b	UTSW	15	4944966	missense	probably damaging	1.00
R2179:Mroh2b	UTSW	15	4921446	critical splice donor site	probably null
R2183:Mroh2b	UTSW	15	4918225	splice site	probably null
R3713:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3714:Mroh2b	UTSW	15	4943649	missense	probably benign	0.01
R3747:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3748:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3749:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3750:Mroh2b	UTSW	15	4952246	nonsense	probably null
R3792:Mroh2b	UTSW	15	4923620	missense	probably damaging	1.00
R3872:Mroh2b	UTSW	15	4925061	nonsense	probably null
R4021:Mroh2b	UTSW	15	4925100	missense	possibly damaging	0.75
R4329:Mroh2b	UTSW	15	4931379	missense	probably damaging	0.99
R4456:Mroh2b	UTSW	15	4947925	missense	probably benign	0.21
R4592:Mroh2b	UTSW	15	4918290	missense	probably damaging	1.00
R4836:Mroh2b	UTSW	15	4904270	missense	probably damaging	1.00
R5050:Mroh2b	UTSW	15	4900450	missense	possibly damaging	0.82
R5230:Mroh2b	UTSW	15	4941522	missense	probably benign	0.07
R5342:Mroh2b	UTSW	15	4914133	nonsense	probably null
R5353:Mroh2b	UTSW	15	4917178	missense	probably damaging	1.00
R5368:Mroh2b	UTSW	15	4905572	missense	probably damaging	1.00
R5424:Mroh2b	UTSW	15	4941612	missense	probably damaging	0.98
R5484:Mroh2b	UTSW	15	4908981	missense	possibly damaging	0.92
R5999:Mroh2b	UTSW	15	4912884	splice site	probably null
R6046:Mroh2b	UTSW	15	4951281	missense	probably benign	0.01
R6081:Mroh2b	UTSW	15	4944377	missense	probably damaging	1.00
R6162:Mroh2b	UTSW	15	4915225	missense	probably damaging	1.00
R6165:Mroh2b	UTSW	15	4918350	missense	probably benign	0.23
R6240:Mroh2b	UTSW	15	4934644	missense	probably benign	0.38
R6487:Mroh2b	UTSW	15	4947239	missense	probably damaging	1.00
R6539:Mroh2b	UTSW	15	4905574	missense	probably damaging	1.00
R6616:Mroh2b	UTSW	15	4953282	missense	probably benign	0.36
R6663:Mroh2b	UTSW	15	4947935	missense	probably benign	0.21
R6820:Mroh2b	UTSW	15	4953274	missense	probably damaging	1.00
R6900:Mroh2b	UTSW	15	4908987	missense	probably benign	0.00
R6990:Mroh2b	UTSW	15	4912802	missense	possibly damaging	0.55
R7067:Mroh2b	UTSW	15	4900504	missense	probably benign	0.35
R7092:Mroh2b	UTSW	15	4934678	missense	possibly damaging	0.92
R7102:Mroh2b	UTSW	15	4948003	missense	probably benign	0.06
R7264:Mroh2b	UTSW	15	4921362	missense	possibly damaging	0.81
R7436:Mroh2b	UTSW	15	4941554	missense	probably benign	0.21
R7462:Mroh2b	UTSW	15	4908627	missense	probably damaging	1.00
R7529:Mroh2b	UTSW	15	4949009	missense	probably damaging	1.00
R7575:Mroh2b	UTSW	15	4934605	missense	probably damaging	1.00
R7579:Mroh2b	UTSW	15	4931061	missense	probably benign	0.09
R7605:Mroh2b	UTSW	15	4945023	missense	probably damaging	1.00
R7624:Mroh2b	UTSW	15	4917131	missense	probably damaging	1.00
R7797:Mroh2b	UTSW	15	4949105	missense	probably benign	0.36
R7848:Mroh2b	UTSW	15	4938379	nonsense	probably null
R7952:Mroh2b	UTSW	15	4951211	missense	probably damaging	1.00
R8088:Mroh2b	UTSW	15	4900503	missense	possibly damaging	0.57
R8207:Mroh2b	UTSW	15	4938410	missense	possibly damaging	0.95
R8242:Mroh2b	UTSW	15	4909040	missense	probably benign	0.04
R8248:Mroh2b	UTSW	15	4931104	missense	probably benign	0.40
R8258:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8259:Mroh2b	UTSW	15	4911909	missense	probably benign	0.01
R8304:Mroh2b	UTSW	15	4925637	missense	probably damaging	0.99
R8316:Mroh2b	UTSW	15	4951264	nonsense	probably null
R8345:Mroh2b	UTSW	15	4944326	missense	probably benign	0.09
R8507:Mroh2b	UTSW	15	4949090	missense	probably damaging	1.00
R8728:Mroh2b	UTSW	15	4905640	missense	probably damaging	1.00
R8747:Mroh2b	UTSW	15	4935300	missense	probably damaging	0.99
R8798:Mroh2b	UTSW	15	4948709	missense	probably damaging	1.00
R8814:Mroh2b	UTSW	15	4941625	missense	possibly damaging	0.61
R8856:Mroh2b	UTSW	15	4931028	nonsense	probably null
R8910:Mroh2b	UTSW	15	4931373	missense	probably benign	0.01
R8913:Mroh2b	UTSW	15	4917528	intron	probably benign
R8941:Mroh2b	UTSW	15	4962124	missense	possibly damaging	0.86
R9014:Mroh2b	UTSW	15	4899188	start codon destroyed	probably null	0.95
R9086:Mroh2b	UTSW	15	4953272	critical splice acceptor site	probably null
R9101:Mroh2b	UTSW	15	4900453	missense	probably benign	0.20
R9118:Mroh2b	UTSW	15	4962091	missense	possibly damaging	0.86
R9393:Mroh2b	UTSW	15	4951184	missense	probably benign
R9429:Mroh2b	UTSW	15	4934425	missense	probably damaging	1.00
R9431:Mroh2b	UTSW	15	4934470	missense	probably damaging	1.00
R9443:Mroh2b	UTSW	15	4944339	missense	probably damaging	1.00
R9447:Mroh2b	UTSW	15	4931341	missense	probably damaging	1.00
X0067:Mroh2b	UTSW	15	4951591	missense	possibly damaging	0.90
Z1177:Mroh2b	UTSW	15	4905005	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGGCACACAAGGATGGAG -3'
(R):5'- GGGACCTAAGGGAACTCTTTC -3'

Sequencing Primer
(F):5'- GCACACAAGGATGGAGTTTTTCC -3'
(R):5'- AGCCATTCTTTTCTCCTTTTGAATG -3'

Posted On

2020-01-23