Incidental Mutation 'R7996:Olfr48'
ID616068
Institutional Source Beutler Lab
Gene Symbol Olfr48
Ensembl Gene ENSMUSG00000075072
Gene Nameolfactory receptor 48
SynonymsIC3, MOR232-5, GA_x6K02T2Q125-51285881-51284976
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7996 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89841793-89848205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89844415 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 186 (D186G)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
Predicted Effect probably benign
Transcript: ENSMUST00000099762
AA Change: D186G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: D186G

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably benign
Transcript: ENSMUST00000214428
AA Change: D186G

PolyPhen 2 Score 0.277 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G T 7: 34,263,599 T216K possibly damaging Het
9230113P08Rik G A 9: 35,909,354 R34H probably damaging Het
9330182L06Rik A C 5: 9,462,881 K958N probably damaging Het
Abcg5 A T 17: 84,670,062 N394K probably damaging Het
Amotl1 T C 9: 14,593,705 D69G possibly damaging Het
Arid5a G T 1: 36,317,445 C121F unknown Het
Ccne2 C A 4: 11,201,347 Q292K probably benign Het
Cfap70 A G 14: 20,409,126 I723T probably benign Het
Chrnd A G 1: 87,191,106 T62A probably damaging Het
Cobll1 T A 2: 65,150,985 H87L possibly damaging Het
Derl1 T G 15: 57,878,574 M122L probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Efcab12 T C 6: 115,823,417 Q215R probably benign Het
Eif3m T C 2: 105,001,349 N289D probably benign Het
Emsy T A 7: 98,593,681 I1084L probably benign Het
Fam71b T C 11: 46,405,062 V87A Het
Gm3336 A T 8: 70,720,497 T53S unknown Het
Gm597 C T 1: 28,778,406 E182K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Katnb1 A T 8: 95,098,015 I546F possibly damaging Het
Memo1 A T 17: 74,258,496 L24Q probably damaging Het
Mmel1 C G 4: 154,892,455 Q529E probably benign Het
Naip5 A G 13: 100,221,656 F1024S probably damaging Het
Olfr1356 A T 10: 78,847,321 V198E probably damaging Het
Paics A G 5: 76,959,429 K110R probably benign Het
Pcdhgc4 C T 18: 37,817,406 S625F probably damaging Het
Pnpla8 T A 12: 44,282,983 L106* probably null Het
Rabggtb T C 3: 153,911,968 H31R probably damaging Het
Rhot1 G A 11: 80,257,537 C601Y probably damaging Het
Rps27 A G 3: 90,213,002 V53A probably benign Het
Sdr39u1 C A 14: 55,897,887 G200* probably null Het
Sesn1 T A 10: 41,894,933 Y153* probably null Het
Slc25a40 A G 5: 8,443,653 T168A probably damaging Het
Smoc2 C T 17: 14,375,468 R286* probably null Het
Smtnl2 T A 11: 72,400,374 K349N probably damaging Het
Snx16 G T 3: 10,435,449 D153E probably benign Het
Ssu72 A C 4: 155,731,993 N144T probably benign Het
Stk40 C A 4: 126,136,874 L296I probably damaging Het
Sult3a2 T C 10: 33,768,258 M225V probably damaging Het
Syne2 T C 12: 76,004,667 L4057P probably damaging Het
Tbx2 A G 11: 85,834,790 H189R probably damaging Het
Tead1 T C 7: 112,842,104 probably null Het
Tgs1 T C 4: 3,605,842 S786P probably damaging Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Trim14 A T 4: 46,533,086 C76S probably benign Het
Tubgcp6 T A 15: 89,109,028 Q506L possibly damaging Het
Vmn2r50 A T 7: 10,047,868 F317I probably damaging Het
Vwa5a T A 9: 38,727,828 Y335* probably null Het
Zgrf1 C T 3: 127,595,924 T1257I possibly damaging Het
Zpr1 A G 9: 46,273,565 N87D possibly damaging Het
Other mutations in Olfr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr48 APN 2 89844095 missense probably benign 0.00
IGL02184:Olfr48 APN 2 89844385 missense probably damaging 0.98
IGL02408:Olfr48 APN 2 89844971 start codon destroyed probably benign 0.04
IGL02437:Olfr48 APN 2 89844784 missense probably damaging 0.98
IGL02985:Olfr48 APN 2 89844340 missense possibly damaging 0.66
IGL03230:Olfr48 APN 2 89844113 missense probably benign
IGL03393:Olfr48 APN 2 89844569 missense probably benign 0.00
R0482:Olfr48 UTSW 2 89844169 missense probably benign 0.20
R0555:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R1268:Olfr48 UTSW 2 89844154 missense probably damaging 0.98
R1617:Olfr48 UTSW 2 89844254 missense probably benign 0.03
R3552:Olfr48 UTSW 2 89844343 missense possibly damaging 0.53
R4172:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4173:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4174:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R5540:Olfr48 UTSW 2 89844667 missense probably damaging 1.00
R5909:Olfr48 UTSW 2 89844391 missense possibly damaging 0.89
R5941:Olfr48 UTSW 2 89844515 missense probably benign 0.07
R7425:Olfr48 UTSW 2 89844445 missense probably damaging 0.99
R7445:Olfr48 UTSW 2 89844272 missense probably damaging 0.99
R7660:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R8026:Olfr48 UTSW 2 89844929 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGACCACAGTAATGTGAGAGAC -3'
(R):5'- CTTCTCACAGTGATGGCCTAC -3'

Sequencing Primer
(F):5'- CACAGGTGGAGAGGGCTTTG -3'
(R):5'- ATGTGGCCATCTGTAAACCG -3'
Posted On2020-01-23