Incidental Mutation 'R7996:Snx16'
ID616070
Institutional Source Beutler Lab
Gene Symbol Snx16
Ensembl Gene ENSMUSG00000027534
Gene Namesorting nexin 16
Synonyms4930522N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7996 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location10417817-10440102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 10435449 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 153 (D153E)
Ref Sequence ENSEMBL: ENSMUSP00000029047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029047] [ENSMUST00000099223] [ENSMUST00000195822]
Predicted Effect probably benign
Transcript: ENSMUST00000029047
AA Change: D153E

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000029047
Gene: ENSMUSG00000027534
AA Change: D153E

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099223
AA Change: D153E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096828
Gene: ENSMUSG00000027534
AA Change: D153E

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195822
SMART Domains Protein: ENSMUSP00000141230
Gene: ENSMUSG00000027534

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Blast:PX 105 134 2e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The protein encoded by this gene associates with late endosome membranes as is involved in tubule formation, cholesterol transport, and transport of tetraspanin CD81. The encoded protein also inhibits cell migration and tumorigenesis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G T 7: 34,263,599 T216K possibly damaging Het
9230113P08Rik G A 9: 35,909,354 R34H probably damaging Het
9330182L06Rik A C 5: 9,462,881 K958N probably damaging Het
Abcg5 A T 17: 84,670,062 N394K probably damaging Het
Amotl1 T C 9: 14,593,705 D69G possibly damaging Het
Arid5a G T 1: 36,317,445 C121F unknown Het
Ccne2 C A 4: 11,201,347 Q292K probably benign Het
Cfap70 A G 14: 20,409,126 I723T probably benign Het
Chrnd A G 1: 87,191,106 T62A probably damaging Het
Cobll1 T A 2: 65,150,985 H87L possibly damaging Het
Derl1 T G 15: 57,878,574 M122L probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Efcab12 T C 6: 115,823,417 Q215R probably benign Het
Eif3m T C 2: 105,001,349 N289D probably benign Het
Emsy T A 7: 98,593,681 I1084L probably benign Het
Fam71b T C 11: 46,405,062 V87A Het
Gm3336 A T 8: 70,720,497 T53S unknown Het
Gm597 C T 1: 28,778,406 E182K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Hr G A 14: 70,563,603 W676* probably null Het
Katnb1 A T 8: 95,098,015 I546F possibly damaging Het
Memo1 A T 17: 74,258,496 L24Q probably damaging Het
Mmel1 C G 4: 154,892,455 Q529E probably benign Het
Naip5 A G 13: 100,221,656 F1024S probably damaging Het
Olfr1356 A T 10: 78,847,321 V198E probably damaging Het
Olfr48 T C 2: 89,844,415 D186G probably benign Het
Paics A G 5: 76,959,429 K110R probably benign Het
Pcdhgc4 C T 18: 37,817,406 S625F probably damaging Het
Pnpla8 T A 12: 44,282,983 L106* probably null Het
Rabggtb T C 3: 153,911,968 H31R probably damaging Het
Rhot1 G A 11: 80,257,537 C601Y probably damaging Het
Rps27 A G 3: 90,213,002 V53A probably benign Het
Sdr39u1 C A 14: 55,897,887 G200* probably null Het
Sesn1 T A 10: 41,894,933 Y153* probably null Het
Slc25a40 A G 5: 8,443,653 T168A probably damaging Het
Smoc2 C T 17: 14,375,468 R286* probably null Het
Smtnl2 T A 11: 72,400,374 K349N probably damaging Het
Ssu72 A C 4: 155,731,993 N144T probably benign Het
Stk40 C A 4: 126,136,874 L296I probably damaging Het
Sult3a2 T C 10: 33,768,258 M225V probably damaging Het
Syne2 T C 12: 76,004,667 L4057P probably damaging Het
Tbx2 A G 11: 85,834,790 H189R probably damaging Het
Tead1 T C 7: 112,842,104 probably null Het
Tgs1 T C 4: 3,605,842 S786P probably damaging Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Trim14 A T 4: 46,533,086 C76S probably benign Het
Tubgcp6 T A 15: 89,109,028 Q506L possibly damaging Het
Vmn2r50 A T 7: 10,047,868 F317I probably damaging Het
Vwa5a T A 9: 38,727,828 Y335* probably null Het
Zgrf1 C T 3: 127,595,924 T1257I possibly damaging Het
Zpr1 A G 9: 46,273,565 N87D possibly damaging Het
Other mutations in Snx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Snx16 APN 3 10419159 missense probably damaging 1.00
IGL02682:Snx16 APN 3 10438175 missense probably damaging 1.00
R0539:Snx16 UTSW 3 10426218 missense probably damaging 0.98
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1771:Snx16 UTSW 3 10419161 missense probably damaging 1.00
R5262:Snx16 UTSW 3 10437832 missense probably damaging 1.00
R5693:Snx16 UTSW 3 10420258 missense probably benign 0.00
R5964:Snx16 UTSW 3 10434481 missense possibly damaging 0.92
R5969:Snx16 UTSW 3 10438157 missense possibly damaging 0.93
R6826:Snx16 UTSW 3 10438088 missense probably damaging 0.99
R7456:Snx16 UTSW 3 10435481 nonsense probably null
R8095:Snx16 UTSW 3 10438184 start codon destroyed probably null 1.00
R8880:Snx16 UTSW 3 10419133 missense probably benign 0.01
Z1177:Snx16 UTSW 3 10420858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTAATTGTGCAGATGACAC -3'
(R):5'- CTCCAAGTTGGTGCTGCTTC -3'

Sequencing Primer
(F):5'- CTGCATGAAGTGAAGATGC -3'
(R):5'- CAGAGAAGCTCCTGAATGTTGCTC -3'
Posted On2020-01-23