Incidental Mutation 'R7996:Hr'
ID616108
Institutional Source Beutler Lab
Gene Symbol Hr
Ensembl Gene ENSMUSG00000022096
Gene Namehairless
SynonymsALUNC, AU, N, ba, bldy, hr, rh, rh-bmh, rhino
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7996 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location70552212-70573548 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 70563603 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 676 (W676*)
Ref Sequence ENSEMBL: ENSMUSP00000124816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022691] [ENSMUST00000161069] [ENSMUST00000163060]
Predicted Effect probably null
Transcript: ENSMUST00000022691
AA Change: W676*
SMART Domains Protein: ENSMUSP00000022691
Gene: ENSMUSG00000022096
AA Change: W676*

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161069
AA Change: W676*
SMART Domains Protein: ENSMUSP00000124816
Gene: ENSMUSG00000022096
AA Change: W676*

DomainStartEndE-ValueType
Blast:JmjC 54 849 N/A BLAST
JmjC 939 1150 5.23e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000163060
AA Change: W705*
SMART Domains Protein: ENSMUSP00000124042
Gene: ENSMUSG00000022096
AA Change: W705*

DomainStartEndE-ValueType
low complexity region 12 21 N/A INTRINSIC
Blast:JmjC 83 878 N/A BLAST
JmjC 968 1179 5.23e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in hair growth. This protein functions as a transcriptional corepressor of multiple nuclear receptors, including thyroid hormone receptor, the retinoic acid receptor-related orphan receptors and the vitamin D receptors, and it interacts with histone deacetylases. The translation of this protein is modulated by a regulatory ORF that exists upstream of the primary ORF. Mutations in this upstream ORF, U2HR, cause Marie Unna hereditary hypotrichosis (MUHH), an autosomal dominant form of genetic hair loss in human. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mutant homozygotes exhibit hair loss, usually wrinkled skin with epidermal cysts. Females do not nurse their pups well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G T 7: 34,263,599 T216K possibly damaging Het
9230113P08Rik G A 9: 35,909,354 R34H probably damaging Het
9330182L06Rik A C 5: 9,462,881 K958N probably damaging Het
Abcg5 A T 17: 84,670,062 N394K probably damaging Het
Amotl1 T C 9: 14,593,705 D69G possibly damaging Het
Arid5a G T 1: 36,317,445 C121F unknown Het
Ccne2 C A 4: 11,201,347 Q292K probably benign Het
Cfap70 A G 14: 20,409,126 I723T probably benign Het
Chrnd A G 1: 87,191,106 T62A probably damaging Het
Cobll1 T A 2: 65,150,985 H87L possibly damaging Het
Derl1 T G 15: 57,878,574 M122L probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Efcab12 T C 6: 115,823,417 Q215R probably benign Het
Eif3m T C 2: 105,001,349 N289D probably benign Het
Emsy T A 7: 98,593,681 I1084L probably benign Het
Fam71b T C 11: 46,405,062 V87A Het
Gm3336 A T 8: 70,720,497 T53S unknown Het
Gm597 C T 1: 28,778,406 E182K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Katnb1 A T 8: 95,098,015 I546F possibly damaging Het
Memo1 A T 17: 74,258,496 L24Q probably damaging Het
Mmel1 C G 4: 154,892,455 Q529E probably benign Het
Naip5 A G 13: 100,221,656 F1024S probably damaging Het
Olfr1356 A T 10: 78,847,321 V198E probably damaging Het
Olfr48 T C 2: 89,844,415 D186G probably benign Het
Paics A G 5: 76,959,429 K110R probably benign Het
Pcdhgc4 C T 18: 37,817,406 S625F probably damaging Het
Pnpla8 T A 12: 44,282,983 L106* probably null Het
Rabggtb T C 3: 153,911,968 H31R probably damaging Het
Rhot1 G A 11: 80,257,537 C601Y probably damaging Het
Rps27 A G 3: 90,213,002 V53A probably benign Het
Sdr39u1 C A 14: 55,897,887 G200* probably null Het
Sesn1 T A 10: 41,894,933 Y153* probably null Het
Slc25a40 A G 5: 8,443,653 T168A probably damaging Het
Smoc2 C T 17: 14,375,468 R286* probably null Het
Smtnl2 T A 11: 72,400,374 K349N probably damaging Het
Snx16 G T 3: 10,435,449 D153E probably benign Het
Ssu72 A C 4: 155,731,993 N144T probably benign Het
Stk40 C A 4: 126,136,874 L296I probably damaging Het
Sult3a2 T C 10: 33,768,258 M225V probably damaging Het
Syne2 T C 12: 76,004,667 L4057P probably damaging Het
Tbx2 A G 11: 85,834,790 H189R probably damaging Het
Tead1 T C 7: 112,842,104 probably null Het
Tgs1 T C 4: 3,605,842 S786P probably damaging Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Trim14 A T 4: 46,533,086 C76S probably benign Het
Tubgcp6 T A 15: 89,109,028 Q506L possibly damaging Het
Vmn2r50 A T 7: 10,047,868 F317I probably damaging Het
Vwa5a T A 9: 38,727,828 Y335* probably null Het
Zgrf1 C T 3: 127,595,924 T1257I possibly damaging Het
Zpr1 A G 9: 46,273,565 N87D possibly damaging Het
Other mutations in Hr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:Hr APN 14 70565297 splice site probably benign
IGL02020:Hr APN 14 70556437 missense probably benign 0.01
IGL02372:Hr APN 14 70558350 missense possibly damaging 0.94
IGL02380:Hr APN 14 70557761 missense probably damaging 0.98
IGL02554:Hr APN 14 70559866 splice site probably benign
IGL02949:Hr APN 14 70559785 missense possibly damaging 0.87
IGL03406:Hr APN 14 70563420 critical splice donor site probably null
angie UTSW 14 70567833 missense probably damaging 0.97
blofeld UTSW 14 70568085 missense probably damaging 1.00
general UTSW 14 70563684 critical splice donor site probably null
kaburo UTSW 14 unclassified
mister_clean UTSW 14 70560065 critical splice donor site probably benign
mushroom UTSW 14 70568085 missense probably damaging 1.00
prune UTSW 14 70571429 missense probably damaging 1.00
ren UTSW 14 70568085 missense probably damaging 1.00
subclinical UTSW 14 70561836 missense possibly damaging 0.89
yuanxiao UTSW 14 70571448 missense probably damaging 1.00
R0018:Hr UTSW 14 70558277 missense probably benign
R0038:Hr UTSW 14 70568085 missense probably damaging 1.00
R0374:Hr UTSW 14 70556476 missense probably benign 0.01
R0511:Hr UTSW 14 70561912 nonsense probably null
R0609:Hr UTSW 14 70559657 missense probably benign
R1828:Hr UTSW 14 70572037 critical splice donor site probably null
R2030:Hr UTSW 14 70571448 missense probably damaging 1.00
R2266:Hr UTSW 14 70558107 missense probably benign
R2267:Hr UTSW 14 70558107 missense probably benign
R2268:Hr UTSW 14 70558107 missense probably benign
R2377:Hr UTSW 14 70557878 missense probably damaging 1.00
R3686:Hr UTSW 14 70557796 missense probably damaging 0.98
R3687:Hr UTSW 14 70557796 missense probably damaging 0.98
R3754:Hr UTSW 14 70567824 missense probably damaging 1.00
R3803:Hr UTSW 14 70557893 missense probably benign 0.01
R3846:Hr UTSW 14 70571453 missense probably damaging 1.00
R3977:Hr UTSW 14 70563584 missense probably benign 0.01
R3978:Hr UTSW 14 70563584 missense probably benign 0.01
R3979:Hr UTSW 14 70563584 missense probably benign 0.01
R4528:Hr UTSW 14 70566383 missense probably damaging 1.00
R4654:Hr UTSW 14 70563573 missense probably damaging 0.99
R4834:Hr UTSW 14 70559922 missense probably damaging 0.98
R4847:Hr UTSW 14 70556476 missense probably benign 0.04
R4863:Hr UTSW 14 70571972 missense probably damaging 1.00
R5292:Hr UTSW 14 70571992 missense probably damaging 1.00
R5452:Hr UTSW 14 70556627 missense probably damaging 1.00
R5717:Hr UTSW 14 70566176 missense probably benign 0.34
R5902:Hr UTSW 14 70557791 missense probably benign 0.02
R6000:Hr UTSW 14 70567833 missense probably damaging 0.97
R6439:Hr UTSW 14 70561836 missense possibly damaging 0.89
R6823:Hr UTSW 14 70565374 missense probably damaging 0.98
R7030:Hr UTSW 14 70563684 critical splice donor site probably null
R7213:Hr UTSW 14 70558350 missense probably damaging 0.99
R7452:Hr UTSW 14 70571486 missense probably damaging 1.00
R7468:Hr UTSW 14 70558212 missense possibly damaging 0.89
R7572:Hr UTSW 14 70561853 missense possibly damaging 0.66
R7997:Hr UTSW 14 70563603 nonsense probably null
X0025:Hr UTSW 14 70566951 splice site probably null
X0026:Hr UTSW 14 70567841 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGATCCTGACCCAGTTTG -3'
(R):5'- AGAGAAAGGTTCCTCCCCAC -3'

Sequencing Primer
(F):5'- AGTTTGTCTCCAGCCAGGG -3'
(R):5'- CCACAAAGGTCAGTTATCTGCATG -3'
Posted On2020-01-23