Incidental Mutation 'R7996:Tubgcp6'
ID616111
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R7996 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89109028 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 506 (Q506L)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000109353]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
AA Change: Q506L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: Q506L

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109353
AA Change: Q506L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: Q506L

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik G T 7: 34,263,599 T216K possibly damaging Het
9230113P08Rik G A 9: 35,909,354 R34H probably damaging Het
9330182L06Rik A C 5: 9,462,881 K958N probably damaging Het
Abcg5 A T 17: 84,670,062 N394K probably damaging Het
Amotl1 T C 9: 14,593,705 D69G possibly damaging Het
Arid5a G T 1: 36,317,445 C121F unknown Het
Ccne2 C A 4: 11,201,347 Q292K probably benign Het
Cfap70 A G 14: 20,409,126 I723T probably benign Het
Chrnd A G 1: 87,191,106 T62A probably damaging Het
Cobll1 T A 2: 65,150,985 H87L possibly damaging Het
Derl1 T G 15: 57,878,574 M122L probably benign Het
Dnah5 T A 15: 28,409,177 N3580K probably damaging Het
Efcab12 T C 6: 115,823,417 Q215R probably benign Het
Eif3m T C 2: 105,001,349 N289D probably benign Het
Emsy T A 7: 98,593,681 I1084L probably benign Het
Fam71b T C 11: 46,405,062 V87A Het
Gm3336 A T 8: 70,720,497 T53S unknown Het
Gm597 C T 1: 28,778,406 E182K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Katnb1 A T 8: 95,098,015 I546F possibly damaging Het
Memo1 A T 17: 74,258,496 L24Q probably damaging Het
Mmel1 C G 4: 154,892,455 Q529E probably benign Het
Naip5 A G 13: 100,221,656 F1024S probably damaging Het
Olfr1356 A T 10: 78,847,321 V198E probably damaging Het
Olfr48 T C 2: 89,844,415 D186G probably benign Het
Paics A G 5: 76,959,429 K110R probably benign Het
Pcdhgc4 C T 18: 37,817,406 S625F probably damaging Het
Pnpla8 T A 12: 44,282,983 L106* probably null Het
Rabggtb T C 3: 153,911,968 H31R probably damaging Het
Rhot1 G A 11: 80,257,537 C601Y probably damaging Het
Rps27 A G 3: 90,213,002 V53A probably benign Het
Sdr39u1 C A 14: 55,897,887 G200* probably null Het
Sesn1 T A 10: 41,894,933 Y153* probably null Het
Slc25a40 A G 5: 8,443,653 T168A probably damaging Het
Smoc2 C T 17: 14,375,468 R286* probably null Het
Smtnl2 T A 11: 72,400,374 K349N probably damaging Het
Snx16 G T 3: 10,435,449 D153E probably benign Het
Ssu72 A C 4: 155,731,993 N144T probably benign Het
Stk40 C A 4: 126,136,874 L296I probably damaging Het
Sult3a2 T C 10: 33,768,258 M225V probably damaging Het
Syne2 T C 12: 76,004,667 L4057P probably damaging Het
Tbx2 A G 11: 85,834,790 H189R probably damaging Het
Tead1 T C 7: 112,842,104 probably null Het
Tgs1 T C 4: 3,605,842 S786P probably damaging Het
Tmco4 T C 4: 139,020,861 Y251H probably damaging Het
Trim14 A T 4: 46,533,086 C76S probably benign Het
Vmn2r50 A T 7: 10,047,868 F317I probably damaging Het
Vwa5a T A 9: 38,727,828 Y335* probably null Het
Zgrf1 C T 3: 127,595,924 T1257I possibly damaging Het
Zpr1 A G 9: 46,273,565 N87D possibly damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2067:Tubgcp6 UTSW 15 89104489 missense probably benign 0.03
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R8095:Tubgcp6 UTSW 15 89122774 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CACATTCAGTACATCTTGGATAACAGG -3'
(R):5'- TGTGTTCCCCACTGTGAGTC -3'

Sequencing Primer
(F):5'- GTACATCTTGGATAACAGGAGACTC -3'
(R):5'- TCCTTTCCTCCAGTGTGAGCTTG -3'
Posted On2020-01-23