Incidental Mutation 'R7997:Casq2'
ID616120
Institutional Source Beutler Lab
Gene Symbol Casq2
Ensembl Gene ENSMUSG00000027861
Gene Namecalsequestrin 2
SynonymsESTM52, cCSQ, cardiac calsequestrin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7997 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location102086415-102146514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102086842 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 68 (K68N)
Ref Sequence ENSEMBL: ENSMUSP00000130482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029454] [ENSMUST00000164123] [ENSMUST00000165540]
Predicted Effect probably damaging
Transcript: ENSMUST00000029454
AA Change: K68N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029454
Gene: ENSMUSG00000027861
AA Change: K68N

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 382 1.4e-226 PFAM
Pfam:Thioredoxin_6 171 364 7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164123
AA Change: K68N

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131232
Gene: ENSMUSG00000027861
AA Change: K68N

DomainStartEndE-ValueType
Pfam:Calsequestrin 2 108 1.3e-46 PFAM
Pfam:Thioredoxin_6 101 293 6.1e-20 PFAM
Pfam:Calsequestrin 106 311 1.9e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165540
AA Change: K68N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130482
Gene: ENSMUSG00000027861
AA Change: K68N

DomainStartEndE-ValueType
Pfam:Calsequestrin 1 386 7.4e-224 PFAM
Pfam:Thioredoxin_6 171 367 9.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene specifies the cardiac muscle family member of the calsequestrin family. Calsequestrin is localized to the sarcoplasmic reticulum in cardiac and slow skeletal muscle cells. The protein is a calcium binding protein that stores calcium for muscle function. Mutations in this gene cause stress-induced polymorphic ventricular tachycardia, also referred to as catecholaminergic polymorphic ventricular tachycardia 2 (CPVT2), a disease characterized by bidirectional ventricular tachycardia that may lead to cardiac arrest. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene cause impaired intracellular calcium regulation in cardiac myocytes and lead to an arrhythmogenic syndrome called catecholaminergic polymorphic ventricular tachycardia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,360 T198A probably benign Het
1700024B05Rik G A 14: 41,944,252 probably benign Het
Abra A C 15: 41,866,197 M269R probably damaging Het
Atp6v0e2 A G 6: 48,537,784 I12V probably benign Het
Bicral T A 17: 46,801,608 I889F probably benign Het
Cabin1 A G 10: 75,733,775 V826A probably benign Het
Cdh23 C A 10: 60,596,739 Q135H possibly damaging Het
Chn2 A T 6: 54,290,285 H253L probably damaging Het
Dnajc22 A G 15: 99,101,633 E233G probably damaging Het
Fbxo6 A G 4: 148,147,395 S96P possibly damaging Het
Gimap6 G T 6: 48,702,315 N262K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Grid2 C A 6: 64,320,136 H494Q possibly damaging Het
Hmgcl T A 4: 135,960,009 Y198* probably null Het
Hmgxb4 A T 8: 75,001,328 Y313F probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Insc A G 7: 114,845,137 D453G probably damaging Het
Iqub T C 6: 24,501,414 N179S possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Kmt2a C A 9: 44,833,923 K1597N unknown Het
Kntc1 T C 5: 123,778,054 V682A probably damaging Het
Mcm9 T A 10: 53,597,406 probably benign Het
Med30 T C 15: 52,730,071 L149P probably damaging Het
Mmd2 T A 5: 142,574,860 H102L possibly damaging Het
Mybph G A 1: 134,194,667 R150H probably damaging Het
Ndufaf4 A G 4: 24,901,919 T156A probably benign Het
Olfr123 T A 17: 37,796,162 C239* probably null Het
Pecr T A 1: 72,276,316 K92* probably null Het
Pithd1 T C 4: 135,976,412 T207A probably benign Het
Prdm10 T A 9: 31,353,425 C719S probably damaging Het
Rasef C A 4: 73,740,562 W316L possibly damaging Het
Robo1 T C 16: 72,904,693 V149A probably damaging Het
Ryr1 A T 7: 29,003,543 V5034D unknown Het
Slc26a10 A G 10: 127,173,309 V661A possibly damaging Het
Slc30a8 T G 15: 52,325,685 I232S possibly damaging Het
Smg1 A G 7: 118,173,141 F1464L unknown Het
Smg1 A C 7: 118,173,142 H1463Q unknown Het
Spata1 G A 3: 146,476,280 A245V probably benign Het
St8sia1 C T 6: 142,963,650 C40Y probably damaging Het
Strn T C 17: 78,684,243 T216A probably benign Het
Tecpr2 G A 12: 110,933,603 E802K probably benign Het
Tenm4 A G 7: 96,874,305 I1685V probably benign Het
Tyw5 T C 1: 57,388,524 D307G probably benign Het
Usp17le A T 7: 104,768,839 D365E possibly damaging Het
Vmn1r13 T G 6: 57,210,344 S163A possibly damaging Het
Vmn1r75 A T 7: 11,880,673 T111S probably damaging Het
Wdr95 G T 5: 149,579,157 probably null Het
Zfp292 G A 4: 34,808,688 P1457L probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Zfp606 T C 7: 12,494,207 S752P possibly damaging Het
Zscan29 T G 2: 121,160,740 S856R probably benign Het
Other mutations in Casq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00910:Casq2 APN 3 102110231 splice site probably benign
IGL02597:Casq2 APN 3 102126637 missense probably damaging 1.00
IGL02863:Casq2 APN 3 102144175 missense possibly damaging 0.84
IGL02902:Casq2 APN 3 102086797 nonsense probably null
IGL03176:Casq2 APN 3 102126654 missense possibly damaging 0.50
R0126:Casq2 UTSW 3 102133399 missense probably damaging 1.00
R0653:Casq2 UTSW 3 102113166 critical splice donor site probably null
R1036:Casq2 UTSW 3 102142215 missense probably damaging 1.00
R1052:Casq2 UTSW 3 102144234 splice site probably null
R1158:Casq2 UTSW 3 102116883 missense probably damaging 1.00
R2886:Casq2 UTSW 3 102144218 missense probably damaging 1.00
R3001:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R3002:Casq2 UTSW 3 102145201 missense probably damaging 0.99
R4155:Casq2 UTSW 3 102133102 splice site probably null
R4715:Casq2 UTSW 3 102110244 missense probably benign 0.00
R6013:Casq2 UTSW 3 102145629 unclassified probably null
R6778:Casq2 UTSW 3 102127931 splice site probably null
R6836:Casq2 UTSW 3 102086760 missense probably damaging 1.00
R6844:Casq2 UTSW 3 102110262 missense possibly damaging 0.70
R7055:Casq2 UTSW 3 102142245 missense probably damaging 1.00
R7638:Casq2 UTSW 3 102086700 missense possibly damaging 0.73
R7761:Casq2 UTSW 3 102145264 missense probably damaging 1.00
R8169:Casq2 UTSW 3 102110312 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATTTACCTGCTCATGGTGGG -3'
(R):5'- TCCACCTTAAGAGTTTGCCCAC -3'

Sequencing Primer
(F):5'- GGGTTTATCTGCTGTCCCTGAG -3'
(R):5'- TCTCTCATACAGGAGGCTG -3'
Posted On2020-01-23