Incidental Mutation 'R7997:Insc'
ID616144
Institutional Source Beutler Lab
Gene Symbol Insc
Ensembl Gene ENSMUSG00000048782
Gene NameINSC spindle orientation adaptor protein
SynonymsInscuteable, 3830422K02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R7997 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location114743694-114850383 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114845137 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 453 (D453G)
Ref Sequence ENSEMBL: ENSMUSP00000112682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117543] [ENSMUST00000169913]
Predicted Effect probably damaging
Transcript: ENSMUST00000117543
AA Change: D453G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112682
Gene: ENSMUSG00000048782
AA Change: D453G

DomainStartEndE-ValueType
Pfam:INSC_LBD 23 69 8.3e-34 PFAM
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169913
AA Change: D453G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129505
Gene: ENSMUSG00000048782
AA Change: D453G

DomainStartEndE-ValueType
PDB:3SF4|F 20 59 1e-17 PDB
low complexity region 60 78 N/A INTRINSIC
SCOP:d1jdha_ 151 497 6e-9 SMART
Blast:ARM 263 286 2e-7 BLAST
Blast:ARM 401 452 7e-21 BLAST
Blast:ARM 453 483 2e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In Drosophila, neuroblasts divide asymmetrically into another neuroblast at the apical side and a smaller ganglion mother cell on the basal side. Cell polarization is precisely regulated by 2 apically localized multiprotein signaling complexes that are tethered by Inscuteable, which regulates their apical localization (Izaki et al., 2006 [PubMed 16458856]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to abnormal cochlear hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,360 T198A probably benign Het
1700024B05Rik G A 14: 41,944,252 probably benign Het
Abra A C 15: 41,866,197 M269R probably damaging Het
Atp6v0e2 A G 6: 48,537,784 I12V probably benign Het
Bicral T A 17: 46,801,608 I889F probably benign Het
Cabin1 A G 10: 75,733,775 V826A probably benign Het
Casq2 A T 3: 102,086,842 K68N probably damaging Het
Cdh23 C A 10: 60,596,739 Q135H possibly damaging Het
Chn2 A T 6: 54,290,285 H253L probably damaging Het
Dnajc22 A G 15: 99,101,633 E233G probably damaging Het
Fbxo6 A G 4: 148,147,395 S96P possibly damaging Het
Gimap6 G T 6: 48,702,315 N262K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grid2 C A 6: 64,320,136 H494Q possibly damaging Het
Hmgcl T A 4: 135,960,009 Y198* probably null Het
Hmgxb4 A T 8: 75,001,328 Y313F probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Iqub T C 6: 24,501,414 N179S possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Kmt2a C A 9: 44,833,923 K1597N unknown Het
Kntc1 T C 5: 123,778,054 V682A probably damaging Het
Mcm9 T A 10: 53,597,406 probably benign Het
Med30 T C 15: 52,730,071 L149P probably damaging Het
Mmd2 T A 5: 142,574,860 H102L possibly damaging Het
Mybph G A 1: 134,194,667 R150H probably damaging Het
Ndufaf4 A G 4: 24,901,919 T156A probably benign Het
Olfr123 T A 17: 37,796,162 C239* probably null Het
Pecr T A 1: 72,276,316 K92* probably null Het
Pithd1 T C 4: 135,976,412 T207A probably benign Het
Prdm10 T A 9: 31,353,425 C719S probably damaging Het
Rasef C A 4: 73,740,562 W316L possibly damaging Het
Robo1 T C 16: 72,904,693 V149A probably damaging Het
Ryr1 A T 7: 29,003,543 V5034D unknown Het
Slc26a10 A G 10: 127,173,309 V661A possibly damaging Het
Slc30a8 T G 15: 52,325,685 I232S possibly damaging Het
Smg1 A G 7: 118,173,141 F1464L unknown Het
Smg1 A C 7: 118,173,142 H1463Q unknown Het
Spata1 G A 3: 146,476,280 A245V probably benign Het
St8sia1 C T 6: 142,963,650 C40Y probably damaging Het
Strn T C 17: 78,684,243 T216A probably benign Het
Tecpr2 G A 12: 110,933,603 E802K probably benign Het
Tenm4 A G 7: 96,874,305 I1685V probably benign Het
Tyw5 T C 1: 57,388,524 D307G probably benign Het
Usp17le A T 7: 104,768,839 D365E possibly damaging Het
Vmn1r13 T G 6: 57,210,344 S163A possibly damaging Het
Vmn1r75 A T 7: 11,880,673 T111S probably damaging Het
Wdr95 G T 5: 149,579,157 probably null Het
Zfp292 G A 4: 34,808,688 P1457L probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Zfp606 T C 7: 12,494,207 S752P possibly damaging Het
Zscan29 T G 2: 121,160,740 S856R probably benign Het
Other mutations in Insc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Insc APN 7 114842154 missense probably damaging 1.00
IGL02381:Insc APN 7 114849942 makesense probably null
IGL02515:Insc APN 7 114769008 missense probably damaging 1.00
IGL03154:Insc APN 7 114842189 missense probably null 1.00
Rare UTSW 7 114791148 missense probably damaging 1.00
R0139:Insc UTSW 7 114769002 missense probably damaging 0.98
R0322:Insc UTSW 7 114792265 missense probably damaging 0.99
R0708:Insc UTSW 7 114845146 missense probably damaging 0.98
R0715:Insc UTSW 7 114845077 missense probably benign 0.06
R1864:Insc UTSW 7 114842178 missense probably benign 0.06
R2069:Insc UTSW 7 114804593 critical splice donor site probably null
R3763:Insc UTSW 7 114790972 missense probably damaging 1.00
R4432:Insc UTSW 7 114769055 intron probably benign
R5331:Insc UTSW 7 114845038 missense probably damaging 0.97
R5346:Insc UTSW 7 114804541 missense possibly damaging 0.69
R5625:Insc UTSW 7 114829067 missense probably damaging 0.99
R5715:Insc UTSW 7 114849841 missense probably benign 0.04
R5860:Insc UTSW 7 114791148 missense probably damaging 1.00
R6199:Insc UTSW 7 114791166 splice site probably null
R7137:Insc UTSW 7 114811615 missense probably benign 0.21
R7440:Insc UTSW 7 114845043 missense possibly damaging 0.78
R7474:Insc UTSW 7 114768823 critical splice donor site probably null
R7504:Insc UTSW 7 114791298 critical splice donor site probably null
R7964:Insc UTSW 7 114846473 missense probably damaging 1.00
R7981:Insc UTSW 7 114829067 missense probably damaging 0.99
Z1176:Insc UTSW 7 114811639 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCTCCACCTGTCTAGCTAG -3'
(R):5'- GCTATGCCCAGGGTTTCTAC -3'

Sequencing Primer
(F):5'- TCCACTAGGGAAGCTCTACC -3'
(R):5'- GGTTTCTACCCTAGCATCTCCCAG -3'
Posted On2020-01-23