Incidental Mutation 'R7997:1700021F05Rik'
ID616150
Institutional Source Beutler Lab
Gene Symbol 1700021F05Rik
Ensembl Gene ENSMUSG00000019797
Gene NameRIKEN cDNA 1700021F05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7997 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location43525133-43540994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43525360 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000119053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057649] [ENSMUST00000147196] [ENSMUST00000216543]
Predicted Effect probably benign
Transcript: ENSMUST00000057649
SMART Domains Protein: ENSMUSP00000137140
Gene: ENSMUSG00000045886

DomainStartEndE-ValueType
Pfam:Pam16 1 125 4.9e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147196
AA Change: T198A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119053
Gene: ENSMUSG00000019797
AA Change: T198A

DomainStartEndE-ValueType
low complexity region 84 96 N/A INTRINSIC
low complexity region 100 125 N/A INTRINSIC
Blast:S4 142 188 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000216543
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024B05Rik G A 14: 41,944,252 probably benign Het
Abra A C 15: 41,866,197 M269R probably damaging Het
Atp6v0e2 A G 6: 48,537,784 I12V probably benign Het
Bicral T A 17: 46,801,608 I889F probably benign Het
Cabin1 A G 10: 75,733,775 V826A probably benign Het
Casq2 A T 3: 102,086,842 K68N probably damaging Het
Cdh23 C A 10: 60,596,739 Q135H possibly damaging Het
Chn2 A T 6: 54,290,285 H253L probably damaging Het
Dnajc22 A G 15: 99,101,633 E233G probably damaging Het
Fbxo6 A G 4: 148,147,395 S96P possibly damaging Het
Gimap6 G T 6: 48,702,315 N262K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grid2 C A 6: 64,320,136 H494Q possibly damaging Het
Hmgcl T A 4: 135,960,009 Y198* probably null Het
Hmgxb4 A T 8: 75,001,328 Y313F probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Insc A G 7: 114,845,137 D453G probably damaging Het
Iqub T C 6: 24,501,414 N179S possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Kmt2a C A 9: 44,833,923 K1597N unknown Het
Kntc1 T C 5: 123,778,054 V682A probably damaging Het
Mcm9 T A 10: 53,597,406 probably benign Het
Med30 T C 15: 52,730,071 L149P probably damaging Het
Mmd2 T A 5: 142,574,860 H102L possibly damaging Het
Mybph G A 1: 134,194,667 R150H probably damaging Het
Ndufaf4 A G 4: 24,901,919 T156A probably benign Het
Olfr123 T A 17: 37,796,162 C239* probably null Het
Pecr T A 1: 72,276,316 K92* probably null Het
Pithd1 T C 4: 135,976,412 T207A probably benign Het
Prdm10 T A 9: 31,353,425 C719S probably damaging Het
Rasef C A 4: 73,740,562 W316L possibly damaging Het
Robo1 T C 16: 72,904,693 V149A probably damaging Het
Ryr1 A T 7: 29,003,543 V5034D unknown Het
Slc26a10 A G 10: 127,173,309 V661A possibly damaging Het
Slc30a8 T G 15: 52,325,685 I232S possibly damaging Het
Smg1 A G 7: 118,173,141 F1464L unknown Het
Smg1 A C 7: 118,173,142 H1463Q unknown Het
Spata1 G A 3: 146,476,280 A245V probably benign Het
St8sia1 C T 6: 142,963,650 C40Y probably damaging Het
Strn T C 17: 78,684,243 T216A probably benign Het
Tecpr2 G A 12: 110,933,603 E802K probably benign Het
Tenm4 A G 7: 96,874,305 I1685V probably benign Het
Tyw5 T C 1: 57,388,524 D307G probably benign Het
Usp17le A T 7: 104,768,839 D365E possibly damaging Het
Vmn1r13 T G 6: 57,210,344 S163A possibly damaging Het
Vmn1r75 A T 7: 11,880,673 T111S probably damaging Het
Wdr95 G T 5: 149,579,157 probably null Het
Zfp292 G A 4: 34,808,688 P1457L probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Zfp606 T C 7: 12,494,207 S752P possibly damaging Het
Zscan29 T G 2: 121,160,740 S856R probably benign Het
Other mutations in 1700021F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1531:1700021F05Rik UTSW 10 43525320 missense probably benign 0.01
R2497:1700021F05Rik UTSW 10 43525267 unclassified probably benign
R4280:1700021F05Rik UTSW 10 43532909 missense probably benign 0.03
R4574:1700021F05Rik UTSW 10 43533010 missense probably damaging 1.00
R5460:1700021F05Rik UTSW 10 43532865 missense probably benign 0.07
R5782:1700021F05Rik UTSW 10 43532903 missense probably benign 0.05
R6103:1700021F05Rik UTSW 10 43532920 missense probably benign 0.08
R6850:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6866:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6867:1700021F05Rik UTSW 10 43532725 small deletion probably benign
R6899:1700021F05Rik UTSW 10 43532784 missense possibly damaging 0.47
R8483:1700021F05Rik UTSW 10 43532919 missense probably benign 0.17
R8676:1700021F05Rik UTSW 10 43532937 missense probably benign 0.14
X0022:1700021F05Rik UTSW 10 43525383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTGACCCCATAAATGACAG -3'
(R):5'- AAGAGTGTCAGGCTGTCTCC -3'

Sequencing Primer
(F):5'- GTGACCCCATAAATGACAGGAGAAC -3'
(R):5'- CCTTGCTCTTCCTATGTGACAG -3'
Posted On2020-01-23