Incidental Mutation 'R7997:Slc26a10'
ID616154
Institutional Source Beutler Lab
Gene Symbol Slc26a10
Ensembl Gene ENSMUSG00000040441
Gene Namesolute carrier family 26, member 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7997 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127171393-127180645 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127173309 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 661 (V661A)
Ref Sequence ENSEMBL: ENSMUSP00000092904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006914] [ENSMUST00000095270] [ENSMUST00000217678] [ENSMUST00000222911]
Predicted Effect probably benign
Transcript: ENSMUST00000006914
SMART Domains Protein: ENSMUSP00000006914
Gene: ENSMUSG00000006731

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
low complexity region 191 202 N/A INTRINSIC
Pfam:Glycos_transf_2 280 450 7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095270
AA Change: V661A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092904
Gene: ENSMUSG00000040441
AA Change: V661A

DomainStartEndE-ValueType
low complexity region 51 78 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:Sulfate_transp 105 497 5.5e-103 PFAM
low complexity region 512 522 N/A INTRINSIC
Pfam:STAS 549 664 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217678
Predicted Effect probably damaging
Transcript: ENSMUST00000222911
AA Change: V653A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,360 T198A probably benign Het
1700024B05Rik G A 14: 41,944,252 probably benign Het
Abra A C 15: 41,866,197 M269R probably damaging Het
Atp6v0e2 A G 6: 48,537,784 I12V probably benign Het
Bicral T A 17: 46,801,608 I889F probably benign Het
Cabin1 A G 10: 75,733,775 V826A probably benign Het
Casq2 A T 3: 102,086,842 K68N probably damaging Het
Cdh23 C A 10: 60,596,739 Q135H possibly damaging Het
Chn2 A T 6: 54,290,285 H253L probably damaging Het
Dnajc22 A G 15: 99,101,633 E233G probably damaging Het
Fbxo6 A G 4: 148,147,395 S96P possibly damaging Het
Gimap6 G T 6: 48,702,315 N262K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Grid2 C A 6: 64,320,136 H494Q possibly damaging Het
Hmgcl T A 4: 135,960,009 Y198* probably null Het
Hmgxb4 A T 8: 75,001,328 Y313F probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Insc A G 7: 114,845,137 D453G probably damaging Het
Iqub T C 6: 24,501,414 N179S possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Kmt2a C A 9: 44,833,923 K1597N unknown Het
Kntc1 T C 5: 123,778,054 V682A probably damaging Het
Mcm9 T A 10: 53,597,406 probably benign Het
Med30 T C 15: 52,730,071 L149P probably damaging Het
Mmd2 T A 5: 142,574,860 H102L possibly damaging Het
Mybph G A 1: 134,194,667 R150H probably damaging Het
Ndufaf4 A G 4: 24,901,919 T156A probably benign Het
Olfr123 T A 17: 37,796,162 C239* probably null Het
Pecr T A 1: 72,276,316 K92* probably null Het
Pithd1 T C 4: 135,976,412 T207A probably benign Het
Prdm10 T A 9: 31,353,425 C719S probably damaging Het
Rasef C A 4: 73,740,562 W316L possibly damaging Het
Robo1 T C 16: 72,904,693 V149A probably damaging Het
Ryr1 A T 7: 29,003,543 V5034D unknown Het
Slc30a8 T G 15: 52,325,685 I232S possibly damaging Het
Smg1 A G 7: 118,173,141 F1464L unknown Het
Smg1 A C 7: 118,173,142 H1463Q unknown Het
Spata1 G A 3: 146,476,280 A245V probably benign Het
St8sia1 C T 6: 142,963,650 C40Y probably damaging Het
Strn T C 17: 78,684,243 T216A probably benign Het
Tecpr2 G A 12: 110,933,603 E802K probably benign Het
Tenm4 A G 7: 96,874,305 I1685V probably benign Het
Tyw5 T C 1: 57,388,524 D307G probably benign Het
Usp17le A T 7: 104,768,839 D365E possibly damaging Het
Vmn1r13 T G 6: 57,210,344 S163A possibly damaging Het
Vmn1r75 A T 7: 11,880,673 T111S probably damaging Het
Wdr95 G T 5: 149,579,157 probably null Het
Zfp292 G A 4: 34,808,688 P1457L probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Zfp606 T C 7: 12,494,207 S752P possibly damaging Het
Zscan29 T G 2: 121,160,740 S856R probably benign Het
Other mutations in Slc26a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Slc26a10 APN 10 127174177 splice site probably benign
IGL01657:Slc26a10 APN 10 127175034 missense probably damaging 1.00
R1202:Slc26a10 UTSW 10 127173348 missense probably damaging 0.99
R1844:Slc26a10 UTSW 10 127178410 missense probably damaging 0.97
R2423:Slc26a10 UTSW 10 127179737 critical splice acceptor site probably null
R4031:Slc26a10 UTSW 10 127178002 missense possibly damaging 0.57
R4779:Slc26a10 UTSW 10 127173355 missense possibly damaging 0.73
R5405:Slc26a10 UTSW 10 127174995 missense probably benign 0.09
R5478:Slc26a10 UTSW 10 127173949 missense probably benign 0.05
R5657:Slc26a10 UTSW 10 127174964 intron probably benign
R5990:Slc26a10 UTSW 10 127178758 missense possibly damaging 0.81
R6681:Slc26a10 UTSW 10 127173661 missense possibly damaging 0.93
R7083:Slc26a10 UTSW 10 127177168 missense probably damaging 1.00
R7365:Slc26a10 UTSW 10 127176847 missense possibly damaging 0.95
R8211:Slc26a10 UTSW 10 127173965 missense probably benign 0.06
R8268:Slc26a10 UTSW 10 127173622 critical splice donor site probably null
Z1177:Slc26a10 UTSW 10 127179658 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCAATCTACTAGGCAGCTTCTC -3'
(R):5'- TTGATTCCTGCAGCTCACCAG -3'

Sequencing Primer
(F):5'- AATCTACTAGGCAGCTTCTCTCTAC -3'
(R):5'- AGGACGATGGGATCTACCTTCTC -3'
Posted On2020-01-23