Incidental Mutation 'R7997:Dnajc22'
ID616162
Institutional Source Beutler Lab
Gene Symbol Dnajc22
Ensembl Gene ENSMUSG00000038009
Gene NameDnaJ heat shock protein family (Hsp40) member C22
Synonyms2810451A06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7997 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location99093170-99104737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99101633 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 233 (E233G)
Ref Sequence ENSEMBL: ENSMUSP00000055482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061295]
Predicted Effect probably damaging
Transcript: ENSMUST00000061295
AA Change: E233G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000055482
Gene: ENSMUSG00000038009
AA Change: E233G

DomainStartEndE-ValueType
Pfam:TM2 1 50 1e-10 PFAM
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
DnaJ 276 335 1.09e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,360 T198A probably benign Het
1700024B05Rik G A 14: 41,944,252 probably benign Het
Abra A C 15: 41,866,197 M269R probably damaging Het
Atp6v0e2 A G 6: 48,537,784 I12V probably benign Het
Bicral T A 17: 46,801,608 I889F probably benign Het
Cabin1 A G 10: 75,733,775 V826A probably benign Het
Casq2 A T 3: 102,086,842 K68N probably damaging Het
Cdh23 C A 10: 60,596,739 Q135H possibly damaging Het
Chn2 A T 6: 54,290,285 H253L probably damaging Het
Fbxo6 A G 4: 148,147,395 S96P possibly damaging Het
Gimap6 G T 6: 48,702,315 N262K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grid2 C A 6: 64,320,136 H494Q possibly damaging Het
Hmgcl T A 4: 135,960,009 Y198* probably null Het
Hmgxb4 A T 8: 75,001,328 Y313F probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Insc A G 7: 114,845,137 D453G probably damaging Het
Iqub T C 6: 24,501,414 N179S possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Kmt2a C A 9: 44,833,923 K1597N unknown Het
Kntc1 T C 5: 123,778,054 V682A probably damaging Het
Mcm9 T A 10: 53,597,406 probably benign Het
Med30 T C 15: 52,730,071 L149P probably damaging Het
Mmd2 T A 5: 142,574,860 H102L possibly damaging Het
Mybph G A 1: 134,194,667 R150H probably damaging Het
Ndufaf4 A G 4: 24,901,919 T156A probably benign Het
Olfr123 T A 17: 37,796,162 C239* probably null Het
Pecr T A 1: 72,276,316 K92* probably null Het
Pithd1 T C 4: 135,976,412 T207A probably benign Het
Prdm10 T A 9: 31,353,425 C719S probably damaging Het
Rasef C A 4: 73,740,562 W316L possibly damaging Het
Robo1 T C 16: 72,904,693 V149A probably damaging Het
Ryr1 A T 7: 29,003,543 V5034D unknown Het
Slc26a10 A G 10: 127,173,309 V661A possibly damaging Het
Slc30a8 T G 15: 52,325,685 I232S possibly damaging Het
Smg1 A G 7: 118,173,141 F1464L unknown Het
Smg1 A C 7: 118,173,142 H1463Q unknown Het
Spata1 G A 3: 146,476,280 A245V probably benign Het
St8sia1 C T 6: 142,963,650 C40Y probably damaging Het
Strn T C 17: 78,684,243 T216A probably benign Het
Tecpr2 G A 12: 110,933,603 E802K probably benign Het
Tenm4 A G 7: 96,874,305 I1685V probably benign Het
Tyw5 T C 1: 57,388,524 D307G probably benign Het
Usp17le A T 7: 104,768,839 D365E possibly damaging Het
Vmn1r13 T G 6: 57,210,344 S163A possibly damaging Het
Vmn1r75 A T 7: 11,880,673 T111S probably damaging Het
Wdr95 G T 5: 149,579,157 probably null Het
Zfp292 G A 4: 34,808,688 P1457L probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Zfp606 T C 7: 12,494,207 S752P possibly damaging Het
Zscan29 T G 2: 121,160,740 S856R probably benign Het
Other mutations in Dnajc22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Dnajc22 APN 15 99101178 missense possibly damaging 0.73
IGL00922:Dnajc22 APN 15 99101579 missense possibly damaging 0.89
IGL02155:Dnajc22 APN 15 99101005 missense probably damaging 1.00
IGL02726:Dnajc22 APN 15 99101000 missense probably damaging 1.00
IGL03074:Dnajc22 APN 15 99101522 missense probably damaging 1.00
F5770:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
R1138:Dnajc22 UTSW 15 99104427 small deletion probably benign
R1628:Dnajc22 UTSW 15 99100936 start codon destroyed probably null 1.00
R2018:Dnajc22 UTSW 15 99101233 missense probably benign 0.06
R2146:Dnajc22 UTSW 15 99104383 missense probably benign 0.04
R4342:Dnajc22 UTSW 15 99104464 nonsense probably null
R4950:Dnajc22 UTSW 15 99101734 missense probably benign 0.29
R7123:Dnajc22 UTSW 15 99101204 missense possibly damaging 0.89
R7173:Dnajc22 UTSW 15 99101306 missense probably benign 0.06
R7640:Dnajc22 UTSW 15 99101114 missense probably damaging 1.00
R8338:Dnajc22 UTSW 15 99101141 missense probably benign 0.00
R8745:Dnajc22 UTSW 15 99101464 missense probably benign 0.01
V7580:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7581:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7582:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
V7583:Dnajc22 UTSW 15 99101482 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACGATACAAAGCCTCAGCG -3'
(R):5'- ATCGCTCAGAGTCCAGACAG -3'

Sequencing Primer
(F):5'- ATACAAAGCCTCAGCGGGGTC -3'
(R):5'- TCTCTGAGGAGACTTACCCGAAG -3'
Posted On2020-01-23