Incidental Mutation 'R7997:Olfr123'
ID616164
Institutional Source Beutler Lab
Gene Symbol Olfr123
Ensembl Gene ENSMUSG00000045202
Gene Nameolfactory receptor 123
SynonymsMOR256-9, GA_x6K02T2PSCP-2255106-2256035
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7997 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37793529-37798134 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 37796162 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 239 (C239*)
Ref Sequence ENSEMBL: ENSMUSP00000149802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054748] [ENSMUST00000214770] [ENSMUST00000215168] [ENSMUST00000216051] [ENSMUST00000216478]
Predicted Effect probably null
Transcript: ENSMUST00000054748
AA Change: C239*
SMART Domains Protein: ENSMUSP00000058678
Gene: ENSMUSG00000045202
AA Change: C239*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 163 2.9e-6 PFAM
Pfam:7tm_4 29 306 2.3e-44 PFAM
Pfam:7TM_GPCR_Srsx 33 144 2.4e-5 PFAM
Pfam:7tm_1 39 288 1.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214770
AA Change: C239*
Predicted Effect probably benign
Transcript: ENSMUST00000215168
Predicted Effect probably null
Transcript: ENSMUST00000216051
AA Change: C239*
Predicted Effect probably benign
Transcript: ENSMUST00000216478
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik T C 10: 43,525,360 T198A probably benign Het
1700024B05Rik G A 14: 41,944,252 probably benign Het
Abra A C 15: 41,866,197 M269R probably damaging Het
Atp6v0e2 A G 6: 48,537,784 I12V probably benign Het
Bicral T A 17: 46,801,608 I889F probably benign Het
Cabin1 A G 10: 75,733,775 V826A probably benign Het
Casq2 A T 3: 102,086,842 K68N probably damaging Het
Cdh23 C A 10: 60,596,739 Q135H possibly damaging Het
Chn2 A T 6: 54,290,285 H253L probably damaging Het
Dnajc22 A G 15: 99,101,633 E233G probably damaging Het
Fbxo6 A G 4: 148,147,395 S96P possibly damaging Het
Gimap6 G T 6: 48,702,315 N262K probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grid2 C A 6: 64,320,136 H494Q possibly damaging Het
Hmgcl T A 4: 135,960,009 Y198* probably null Het
Hmgxb4 A T 8: 75,001,328 Y313F probably damaging Het
Hr G A 14: 70,563,603 W676* probably null Het
Insc A G 7: 114,845,137 D453G probably damaging Het
Iqub T C 6: 24,501,414 N179S possibly damaging Het
Kdm3b T A 18: 34,808,283 S276T probably benign Het
Kmt2a C A 9: 44,833,923 K1597N unknown Het
Kntc1 T C 5: 123,778,054 V682A probably damaging Het
Mcm9 T A 10: 53,597,406 probably benign Het
Med30 T C 15: 52,730,071 L149P probably damaging Het
Mmd2 T A 5: 142,574,860 H102L possibly damaging Het
Mybph G A 1: 134,194,667 R150H probably damaging Het
Ndufaf4 A G 4: 24,901,919 T156A probably benign Het
Pecr T A 1: 72,276,316 K92* probably null Het
Pithd1 T C 4: 135,976,412 T207A probably benign Het
Prdm10 T A 9: 31,353,425 C719S probably damaging Het
Rasef C A 4: 73,740,562 W316L possibly damaging Het
Robo1 T C 16: 72,904,693 V149A probably damaging Het
Ryr1 A T 7: 29,003,543 V5034D unknown Het
Slc26a10 A G 10: 127,173,309 V661A possibly damaging Het
Slc30a8 T G 15: 52,325,685 I232S possibly damaging Het
Smg1 A G 7: 118,173,141 F1464L unknown Het
Smg1 A C 7: 118,173,142 H1463Q unknown Het
Spata1 G A 3: 146,476,280 A245V probably benign Het
St8sia1 C T 6: 142,963,650 C40Y probably damaging Het
Strn T C 17: 78,684,243 T216A probably benign Het
Tecpr2 G A 12: 110,933,603 E802K probably benign Het
Tenm4 A G 7: 96,874,305 I1685V probably benign Het
Tyw5 T C 1: 57,388,524 D307G probably benign Het
Usp17le A T 7: 104,768,839 D365E possibly damaging Het
Vmn1r13 T G 6: 57,210,344 S163A possibly damaging Het
Vmn1r75 A T 7: 11,880,673 T111S probably damaging Het
Wdr95 G T 5: 149,579,157 probably null Het
Zfp292 G A 4: 34,808,688 P1457L probably damaging Het
Zfp606 T A 7: 12,489,592 V10E probably damaging Het
Zfp606 T C 7: 12,494,207 S752P possibly damaging Het
Zscan29 T G 2: 121,160,740 S856R probably benign Het
Other mutations in Olfr123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Olfr123 APN 17 37795522 missense probably damaging 0.99
IGL03030:Olfr123 APN 17 37796271 missense probably damaging 1.00
IGL03107:Olfr123 APN 17 37795788 missense probably benign 0.01
R0329:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0330:Olfr123 UTSW 17 37795989 missense probably benign 0.01
R0524:Olfr123 UTSW 17 37795605 nonsense probably null
R0581:Olfr123 UTSW 17 37796102 missense probably damaging 1.00
R1288:Olfr123 UTSW 17 37795693 missense probably damaging 0.98
R1897:Olfr123 UTSW 17 37796184 missense probably benign 0.22
R3751:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3753:Olfr123 UTSW 17 37796232 missense possibly damaging 0.95
R3780:Olfr123 UTSW 17 37796004 missense probably damaging 1.00
R3947:Olfr123 UTSW 17 37796115 missense probably benign
R5925:Olfr123 UTSW 17 37795591 missense probably benign 0.00
R5987:Olfr123 UTSW 17 37796357 missense probably benign
R6369:Olfr123 UTSW 17 37795496 missense probably benign 0.02
R6891:Olfr123 UTSW 17 37795504 missense probably benign
R7320:Olfr123 UTSW 17 37796357 missense probably benign
R8153:Olfr123 UTSW 17 37795476 missense probably benign 0.00
R8793:Olfr123 UTSW 17 37796364 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TCCATGATCAAGCTTGCCTG -3'
(R):5'- GTAAAGTCCTGTCACACTCCAG -3'

Sequencing Primer
(F):5'- CCTGTGTGGACATTCATGCCAATG -3'
(R):5'- TCTATTGAAGAGCCGTCCGAG -3'
Posted On2020-01-23