Incidental Mutation 'R7998:Acsl3'
ID 616168
Institutional Source Beutler Lab
Gene Symbol Acsl3
Ensembl Gene ENSMUSG00000032883
Gene Name acyl-CoA synthetase long-chain family member 3
Synonyms C85929, 2610510B12Rik, Facl3
MMRRC Submission 046038-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.544) question?
Stock # R7998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 78635600-78685462 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78671988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 294 (P294L)
Ref Sequence ENSEMBL: ENSMUSP00000045291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035779] [ENSMUST00000134566] [ENSMUST00000142704]
AlphaFold Q9CZW4
Predicted Effect probably damaging
Transcript: ENSMUST00000035779
AA Change: P294L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045291
Gene: ENSMUSG00000032883
AA Change: P294L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134566
AA Change: P142L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117952
Gene: ENSMUSG00000032883
AA Change: P142L

DomainStartEndE-ValueType
Pfam:AMP-binding 1 435 4.3e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142704
AA Change: P294L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121695
Gene: ENSMUSG00000032883
AA Change: P294L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:AMP-binding 113 587 2.5e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of the long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme is highly expressed in brain, and preferentially utilizes myristate, arachidonate, and eicosapentaenoate as substrates. The amino acid sequence of this isozyme is 92% identical to that of rat homolog. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit decreased blood percentages of CD4 T cells and B cells, and a decreased IgG1 response to ovalbumin. Male mutant mice exhibit growth retardation, reduced size and reduced total tissue and lean body mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 35,818,649 (GRCm39) R216C probably benign Het
Alox12b T C 11: 69,059,663 (GRCm39) Y572H probably damaging Het
Arid1b A G 17: 5,377,959 (GRCm39) D1236G probably damaging Het
Astl T C 2: 127,192,419 (GRCm39) L254P probably damaging Het
Btbd7 A C 12: 102,761,499 (GRCm39) L562R probably damaging Het
Chl1 T C 6: 103,706,250 (GRCm39) V1195A probably benign Het
Ciao2b T A 8: 105,367,668 (GRCm39) S94C probably damaging Het
Cib1 A T 7: 79,878,162 (GRCm39) Y105* probably null Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Cpne6 A C 14: 55,753,751 (GRCm39) Q403P probably damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dicer1 A T 12: 104,670,328 (GRCm39) F1079Y probably damaging Het
Dsc2 T A 18: 20,167,720 (GRCm39) Q724H possibly damaging Het
Fbxw16 A G 9: 109,265,766 (GRCm39) V351A probably damaging Het
G2e3 A T 12: 51,400,624 (GRCm39) E59D probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm10837 G T 14: 122,728,053 (GRCm39) probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr18 T C 14: 122,149,393 (GRCm39) I211V probably benign Het
Gstm7 T A 3: 107,837,657 (GRCm39) D98V probably damaging Het
Hspa8 A G 9: 40,715,810 (GRCm39) Y525C probably damaging Het
Itga7 T C 10: 128,770,020 (GRCm39) S55P probably damaging Het
Itpr1 T C 6: 108,394,909 (GRCm39) V1674A possibly damaging Het
Itsn1 G T 16: 91,647,824 (GRCm39) G893C unknown Het
Kcnc1 A G 7: 46,047,223 (GRCm39) D41G probably benign Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Leo1 G T 9: 75,352,558 (GRCm39) G34C probably benign Het
Map4 G A 9: 109,908,929 (GRCm39) V1050M probably damaging Het
Mast3 A G 8: 71,236,214 (GRCm39) V722A probably benign Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mier1 T C 4: 103,019,812 (GRCm39) F512S probably benign Het
Mix23 T A 16: 35,905,403 (GRCm39) V65D probably benign Het
Mov10l1 T A 15: 88,937,642 (GRCm39) V1147E probably damaging Het
Mroh7 T C 4: 106,568,478 (GRCm39) E409G probably benign Het
Muc16 G T 9: 18,551,188 (GRCm39) P5035Q probably benign Het
Nemp1 C A 10: 127,529,358 (GRCm39) S213R probably damaging Het
Npffr2 T C 5: 89,731,149 (GRCm39) Y360H probably damaging Het
Nrxn2 T C 19: 6,559,905 (GRCm39) V1221A probably damaging Het
Nup107 A G 10: 117,593,899 (GRCm39) F765L probably damaging Het
Nup188 T C 2: 30,220,983 (GRCm39) L991P probably damaging Het
Or13f5 A T 4: 52,825,970 (GRCm39) D191V possibly damaging Het
Or5ac23 T A 16: 59,149,633 (GRCm39) M80L probably benign Het
Pla2g7 A T 17: 43,922,209 (GRCm39) I363L probably benign Het
Ppp2r1a T C 17: 21,181,901 (GRCm39) F473S possibly damaging Het
Prex1 A G 2: 166,428,965 (GRCm39) probably null Het
Ptov1 A G 7: 44,514,353 (GRCm39) V263A probably damaging Het
Reg3a T C 6: 78,358,132 (GRCm39) V21A probably benign Het
Sdk2 T A 11: 113,750,764 (GRCm39) I550F probably benign Het
Shprh T A 10: 11,061,085 (GRCm39) W1133R probably damaging Het
Slc28a2b T C 2: 122,324,839 (GRCm39) L137P probably damaging Het
Syne2 T C 12: 76,134,632 (GRCm39) V1297A probably damaging Het
Themis2 A G 4: 132,519,875 (GRCm39) I50T probably damaging Het
Tmprss15 C A 16: 78,798,731 (GRCm39) L650F possibly damaging Het
Ttc41 C A 10: 86,572,711 (GRCm39) N694K probably benign Het
Ttll9 T C 2: 152,833,546 (GRCm39) Y215H possibly damaging Het
Ttn C A 2: 76,733,653 (GRCm39) V4541L unknown Het
Usp32 G T 11: 84,885,252 (GRCm39) A1265E probably damaging Het
Vcan T A 13: 89,852,446 (GRCm39) D838V probably damaging Het
Vmn2r88 T C 14: 51,651,565 (GRCm39) I293T Het
Wdr36 T G 18: 32,985,572 (GRCm39) D496E probably damaging Het
Wrn T C 8: 33,782,671 (GRCm39) N753S probably benign Het
Zmat3 T C 3: 32,395,815 (GRCm39) R231G possibly damaging Het
Other mutations in Acsl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01288:Acsl3 APN 1 78,677,476 (GRCm39) missense possibly damaging 0.79
IGL02201:Acsl3 APN 1 78,676,870 (GRCm39) missense probably damaging 1.00
IGL03162:Acsl3 APN 1 78,676,887 (GRCm39) critical splice donor site probably null
R0601:Acsl3 UTSW 1 78,673,896 (GRCm39) missense probably damaging 1.00
R0658:Acsl3 UTSW 1 78,679,004 (GRCm39) missense probably damaging 1.00
R1389:Acsl3 UTSW 1 78,665,999 (GRCm39) missense probably benign
R1468:Acsl3 UTSW 1 78,684,126 (GRCm39) missense probably benign 0.03
R1468:Acsl3 UTSW 1 78,684,126 (GRCm39) missense probably benign 0.03
R1697:Acsl3 UTSW 1 78,683,114 (GRCm39) splice site probably benign
R2083:Acsl3 UTSW 1 78,677,528 (GRCm39) missense probably damaging 0.99
R2125:Acsl3 UTSW 1 78,659,678 (GRCm39) missense probably damaging 0.97
R2191:Acsl3 UTSW 1 78,676,857 (GRCm39) missense probably damaging 1.00
R2299:Acsl3 UTSW 1 78,676,827 (GRCm39) missense probably damaging 1.00
R2395:Acsl3 UTSW 1 78,683,085 (GRCm39) missense probably benign 0.00
R2964:Acsl3 UTSW 1 78,672,011 (GRCm39) missense probably benign 0.01
R3403:Acsl3 UTSW 1 78,673,839 (GRCm39) missense probably damaging 1.00
R4655:Acsl3 UTSW 1 78,668,063 (GRCm39) missense probably damaging 1.00
R5537:Acsl3 UTSW 1 78,684,073 (GRCm39) missense probably damaging 1.00
R5823:Acsl3 UTSW 1 78,666,003 (GRCm39) missense probably benign
R6239:Acsl3 UTSW 1 78,674,182 (GRCm39) missense probably benign 0.00
R6376:Acsl3 UTSW 1 78,674,182 (GRCm39) missense possibly damaging 0.81
R6650:Acsl3 UTSW 1 78,659,639 (GRCm39) missense probably benign 0.03
R7031:Acsl3 UTSW 1 78,666,000 (GRCm39) missense probably benign
R7282:Acsl3 UTSW 1 78,659,709 (GRCm39) missense probably damaging 0.97
R7733:Acsl3 UTSW 1 78,665,953 (GRCm39) critical splice acceptor site probably null
R7891:Acsl3 UTSW 1 78,681,305 (GRCm39) missense probably benign 0.02
R8056:Acsl3 UTSW 1 78,659,611 (GRCm39) missense probably damaging 1.00
R8083:Acsl3 UTSW 1 78,669,844 (GRCm39) missense probably damaging 1.00
R8084:Acsl3 UTSW 1 78,669,844 (GRCm39) missense probably damaging 1.00
R8135:Acsl3 UTSW 1 78,674,712 (GRCm39) missense probably benign 0.00
R8982:Acsl3 UTSW 1 78,677,485 (GRCm39) missense probably benign 0.00
R9267:Acsl3 UTSW 1 78,674,623 (GRCm39) missense probably damaging 1.00
R9380:Acsl3 UTSW 1 78,659,602 (GRCm39) missense possibly damaging 0.47
X0025:Acsl3 UTSW 1 78,669,919 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCCTCCGTGGCTCTAATTATAGAC -3'
(R):5'- AGACACCTGGGGAATACTTTAACC -3'

Sequencing Primer
(F):5'- CCGTGGCTCTAATTATAGACTTAACC -3'
(R):5'- CCTGGGGAATACTTTAACCATCTAC -3'
Posted On 2020-01-23