Incidental Mutation 'R7998:Slc28a2b'
ID 616172
Institutional Source Beutler Lab
Gene Symbol Slc28a2b
Ensembl Gene ENSMUSG00000079071
Gene Name solute carrier family 28 member 2b
Synonyms Gm14085
MMRRC Submission 046038-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 122315422-122358521 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122324839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 137 (L137P)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
AlphaFold A2AWR5
Predicted Effect probably damaging
Transcript: ENSMUST00000110521
AA Change: L137P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: L137P

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 35,818,649 (GRCm39) R216C probably benign Het
Acsl3 C T 1: 78,671,988 (GRCm39) P294L probably damaging Het
Alox12b T C 11: 69,059,663 (GRCm39) Y572H probably damaging Het
Arid1b A G 17: 5,377,959 (GRCm39) D1236G probably damaging Het
Astl T C 2: 127,192,419 (GRCm39) L254P probably damaging Het
Btbd7 A C 12: 102,761,499 (GRCm39) L562R probably damaging Het
Chl1 T C 6: 103,706,250 (GRCm39) V1195A probably benign Het
Ciao2b T A 8: 105,367,668 (GRCm39) S94C probably damaging Het
Cib1 A T 7: 79,878,162 (GRCm39) Y105* probably null Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Cpne6 A C 14: 55,753,751 (GRCm39) Q403P probably damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dicer1 A T 12: 104,670,328 (GRCm39) F1079Y probably damaging Het
Dsc2 T A 18: 20,167,720 (GRCm39) Q724H possibly damaging Het
Fbxw16 A G 9: 109,265,766 (GRCm39) V351A probably damaging Het
G2e3 A T 12: 51,400,624 (GRCm39) E59D probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm10837 G T 14: 122,728,053 (GRCm39) probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr18 T C 14: 122,149,393 (GRCm39) I211V probably benign Het
Gstm7 T A 3: 107,837,657 (GRCm39) D98V probably damaging Het
Hspa8 A G 9: 40,715,810 (GRCm39) Y525C probably damaging Het
Itga7 T C 10: 128,770,020 (GRCm39) S55P probably damaging Het
Itpr1 T C 6: 108,394,909 (GRCm39) V1674A possibly damaging Het
Itsn1 G T 16: 91,647,824 (GRCm39) G893C unknown Het
Kcnc1 A G 7: 46,047,223 (GRCm39) D41G probably benign Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Leo1 G T 9: 75,352,558 (GRCm39) G34C probably benign Het
Map4 G A 9: 109,908,929 (GRCm39) V1050M probably damaging Het
Mast3 A G 8: 71,236,214 (GRCm39) V722A probably benign Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mier1 T C 4: 103,019,812 (GRCm39) F512S probably benign Het
Mix23 T A 16: 35,905,403 (GRCm39) V65D probably benign Het
Mov10l1 T A 15: 88,937,642 (GRCm39) V1147E probably damaging Het
Mroh7 T C 4: 106,568,478 (GRCm39) E409G probably benign Het
Muc16 G T 9: 18,551,188 (GRCm39) P5035Q probably benign Het
Nemp1 C A 10: 127,529,358 (GRCm39) S213R probably damaging Het
Npffr2 T C 5: 89,731,149 (GRCm39) Y360H probably damaging Het
Nrxn2 T C 19: 6,559,905 (GRCm39) V1221A probably damaging Het
Nup107 A G 10: 117,593,899 (GRCm39) F765L probably damaging Het
Nup188 T C 2: 30,220,983 (GRCm39) L991P probably damaging Het
Or13f5 A T 4: 52,825,970 (GRCm39) D191V possibly damaging Het
Or5ac23 T A 16: 59,149,633 (GRCm39) M80L probably benign Het
Pla2g7 A T 17: 43,922,209 (GRCm39) I363L probably benign Het
Ppp2r1a T C 17: 21,181,901 (GRCm39) F473S possibly damaging Het
Prex1 A G 2: 166,428,965 (GRCm39) probably null Het
Ptov1 A G 7: 44,514,353 (GRCm39) V263A probably damaging Het
Reg3a T C 6: 78,358,132 (GRCm39) V21A probably benign Het
Sdk2 T A 11: 113,750,764 (GRCm39) I550F probably benign Het
Shprh T A 10: 11,061,085 (GRCm39) W1133R probably damaging Het
Syne2 T C 12: 76,134,632 (GRCm39) V1297A probably damaging Het
Themis2 A G 4: 132,519,875 (GRCm39) I50T probably damaging Het
Tmprss15 C A 16: 78,798,731 (GRCm39) L650F possibly damaging Het
Ttc41 C A 10: 86,572,711 (GRCm39) N694K probably benign Het
Ttll9 T C 2: 152,833,546 (GRCm39) Y215H possibly damaging Het
Ttn C A 2: 76,733,653 (GRCm39) V4541L unknown Het
Usp32 G T 11: 84,885,252 (GRCm39) A1265E probably damaging Het
Vcan T A 13: 89,852,446 (GRCm39) D838V probably damaging Het
Vmn2r88 T C 14: 51,651,565 (GRCm39) I293T Het
Wdr36 T G 18: 32,985,572 (GRCm39) D496E probably damaging Het
Wrn T C 8: 33,782,671 (GRCm39) N753S probably benign Het
Zmat3 T C 3: 32,395,815 (GRCm39) R231G possibly damaging Het
Other mutations in Slc28a2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slc28a2b APN 2 122,347,527 (GRCm39) missense probably damaging 0.98
IGL01160:Slc28a2b APN 2 122,355,277 (GRCm39) critical splice acceptor site probably null
IGL01838:Slc28a2b APN 2 122,348,464 (GRCm39) missense possibly damaging 0.65
IGL01895:Slc28a2b APN 2 122,355,572 (GRCm39) missense possibly damaging 0.75
IGL02999:Slc28a2b APN 2 122,344,995 (GRCm39) splice site probably benign
Wilted UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
K2124:Slc28a2b UTSW 2 122,355,634 (GRCm39) missense probably benign 0.00
R0084:Slc28a2b UTSW 2 122,353,314 (GRCm39) missense possibly damaging 0.95
R0092:Slc28a2b UTSW 2 122,348,078 (GRCm39) splice site probably benign
R0127:Slc28a2b UTSW 2 122,347,550 (GRCm39) critical splice donor site probably null
R0200:Slc28a2b UTSW 2 122,357,928 (GRCm39) makesense probably null
R0276:Slc28a2b UTSW 2 122,352,409 (GRCm39) missense probably damaging 1.00
R0309:Slc28a2b UTSW 2 122,348,034 (GRCm39) missense probably benign 0.04
R0403:Slc28a2b UTSW 2 122,352,335 (GRCm39) missense probably damaging 1.00
R0600:Slc28a2b UTSW 2 122,344,879 (GRCm39) missense probably damaging 0.97
R0612:Slc28a2b UTSW 2 122,352,179 (GRCm39) missense probably damaging 1.00
R1676:Slc28a2b UTSW 2 122,352,340 (GRCm39) missense probably damaging 0.99
R1801:Slc28a2b UTSW 2 122,352,133 (GRCm39) missense possibly damaging 0.57
R1986:Slc28a2b UTSW 2 122,357,910 (GRCm39) missense probably benign 0.00
R2050:Slc28a2b UTSW 2 122,353,349 (GRCm39) missense probably benign 0.21
R3078:Slc28a2b UTSW 2 122,344,895 (GRCm39) missense possibly damaging 0.63
R4075:Slc28a2b UTSW 2 122,344,892 (GRCm39) missense probably benign 0.00
R4096:Slc28a2b UTSW 2 122,353,209 (GRCm39) missense probably damaging 1.00
R4744:Slc28a2b UTSW 2 122,353,286 (GRCm39) nonsense probably null
R4796:Slc28a2b UTSW 2 122,344,940 (GRCm39) missense probably damaging 0.99
R5033:Slc28a2b UTSW 2 122,353,395 (GRCm39) critical splice donor site probably null
R5069:Slc28a2b UTSW 2 122,324,854 (GRCm39) missense possibly damaging 0.93
R5288:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5385:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5386:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5442:Slc28a2b UTSW 2 122,317,350 (GRCm39) missense probably benign
R5795:Slc28a2b UTSW 2 122,348,475 (GRCm39) missense possibly damaging 0.79
R6258:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6260:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6383:Slc28a2b UTSW 2 122,355,288 (GRCm39) missense probably benign 0.00
R7226:Slc28a2b UTSW 2 122,353,013 (GRCm39) missense probably benign 0.00
R7574:Slc28a2b UTSW 2 122,353,325 (GRCm39) missense not run
R7633:Slc28a2b UTSW 2 122,317,161 (GRCm39) missense probably null 0.05
R7705:Slc28a2b UTSW 2 122,352,110 (GRCm39) critical splice acceptor site probably null
R7726:Slc28a2b UTSW 2 122,317,214 (GRCm39) missense probably damaging 0.99
R8269:Slc28a2b UTSW 2 122,352,169 (GRCm39) missense probably damaging 1.00
R8337:Slc28a2b UTSW 2 122,355,617 (GRCm39) missense probably benign 0.06
R8546:Slc28a2b UTSW 2 122,353,235 (GRCm39) missense probably benign 0.14
R8817:Slc28a2b UTSW 2 122,348,988 (GRCm39) missense possibly damaging 0.95
R8931:Slc28a2b UTSW 2 122,348,983 (GRCm39) missense
R9070:Slc28a2b UTSW 2 122,352,154 (GRCm39) missense probably damaging 1.00
R9542:Slc28a2b UTSW 2 122,324,822 (GRCm39) missense probably benign 0.26
R9702:Slc28a2b UTSW 2 122,354,012 (GRCm39) missense probably damaging 1.00
R9782:Slc28a2b UTSW 2 122,352,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCATGGAGGCTCAGC -3'
(R):5'- AGCTTTGATTCCCACCATGATATTC -3'

Sequencing Primer
(F):5'- GGCTCAGCCTTCCTGACC -3'
(R):5'- TCTGCCCTATTATCAGATAAGGTTG -3'
Posted On 2020-01-23