Incidental Mutation 'R7998:Zmat3'
ID616176
Institutional Source Beutler Lab
Gene Symbol Zmat3
Ensembl Gene ENSMUSG00000027663
Gene Namezinc finger matrin type 3
SynonymsWig1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location32334792-32366014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32341666 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 231 (R231G)
Ref Sequence ENSEMBL: ENSMUSP00000131317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029199] [ENSMUST00000168566]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029199
AA Change: R231G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029199
Gene: ENSMUSG00000027663
AA Change: R231G

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168566
AA Change: R231G

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131317
Gene: ENSMUSG00000027663
AA Change: R231G

DomainStartEndE-ValueType
ZnF_U1 67 101 1.03e-10 SMART
ZnF_C2H2 70 94 9.46e0 SMART
ZnF_U1 145 179 1.11e-10 SMART
ZnF_C2H2 148 172 5.54e1 SMART
ZnF_U1 243 277 7.72e-10 SMART
ZnF_C2H2 246 270 6.92e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing three zinc finger domains and a nuclear localization signal. The mRNA and the protein of this gene are upregulated by wildtype p53 and overexpression of this gene inhibits tumor cell growth, suggesting that this gene may have a role in the p53-dependent growth regulatory pathway. Alternative splicing of this gene results in two transcript variants encoding two isoforms differing in only one amino acid. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Other mutations in Zmat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Zmat3 APN 3 32341678 missense possibly damaging 0.82
IGL01687:Zmat3 APN 3 32341531 missense probably damaging 1.00
IGL02251:Zmat3 APN 3 32345583 splice site probably benign
IGL03110:Zmat3 APN 3 32345552 missense probably damaging 0.98
R0585:Zmat3 UTSW 3 32361105 missense probably damaging 0.96
R1258:Zmat3 UTSW 3 32343671 missense probably damaging 0.99
R1916:Zmat3 UTSW 3 32343348 missense probably benign 0.00
R1968:Zmat3 UTSW 3 32360982 missense probably damaging 1.00
R4805:Zmat3 UTSW 3 32343355 missense probably benign 0.00
R4906:Zmat3 UTSW 3 32343687 missense probably damaging 1.00
R6252:Zmat3 UTSW 3 32341621 missense possibly damaging 0.55
R6844:Zmat3 UTSW 3 32341495 missense probably damaging 1.00
R8316:Zmat3 UTSW 3 32341521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCACTGAACGTAGCCCAGG -3'
(R):5'- GACATTCTAAGGATCTGCGTGTG -3'

Sequencing Primer
(F):5'- GAACGTAGCCCAGGTTCTCCATC -3'
(R):5'- TCACGCATTGACTAGGCTAG -3'
Posted On2020-01-23