Incidental Mutation 'R7998:Gstm7'
ID616177
Institutional Source Beutler Lab
Gene Symbol Gstm7
Ensembl Gene ENSMUSG00000004035
Gene Nameglutathione S-transferase, mu 7
SynonymsCd203c, 0610005A07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107926334-107931817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107930341 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 98 (D98V)
Ref Sequence ENSEMBL: ENSMUSP00000004137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004137] [ENSMUST00000106687] [ENSMUST00000106688] [ENSMUST00000124215] [ENSMUST00000133947]
PDB Structure
Crystal structure of mouse glutathione S-transferase, mu7 (GSTM7) at 1.6 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000004137
AA Change: D98V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004137
Gene: ENSMUSG00000004035
AA Change: D98V

DomainStartEndE-ValueType
Pfam:GST_N 3 82 2.2e-23 PFAM
Pfam:GST_C_3 42 190 1.2e-9 PFAM
Pfam:GST_C 104 191 5.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106687
AA Change: D98V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102298
Gene: ENSMUSG00000004035
AA Change: D98V

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.8e-24 PFAM
Pfam:GST_N_3 11 93 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106688
AA Change: D94V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102299
Gene: ENSMUSG00000004035
AA Change: D94V

DomainStartEndE-ValueType
Pfam:GST_N_3 4 89 8.8e-7 PFAM
Pfam:GST_N 5 78 4.2e-19 PFAM
Pfam:GST_C 100 188 5.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124215
AA Change: D88V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118707
Gene: ENSMUSG00000004035
AA Change: D88V

DomainStartEndE-ValueType
Pfam:GST_N 1 72 8.6e-20 PFAM
Pfam:GST_N_3 3 83 4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133947
AA Change: D139V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122567
Gene: ENSMUSG00000004035
AA Change: D139V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:GST_N 45 123 2.6e-19 PFAM
Pfam:GST_N_3 54 134 1.4e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Gstm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Gstm7 APN 3 107930278 missense possibly damaging 0.93
PIT4142001:Gstm7 UTSW 3 107931483 frame shift probably null
R0095:Gstm7 UTSW 3 107930563 splice site probably benign
R0961:Gstm7 UTSW 3 107926986 unclassified probably benign
R1052:Gstm7 UTSW 3 107926950 missense probably benign 0.05
R2121:Gstm7 UTSW 3 107926914 missense probably benign 0.00
R4610:Gstm7 UTSW 3 107926919 missense possibly damaging 0.65
R5966:Gstm7 UTSW 3 107931431 intron probably benign
R6393:Gstm7 UTSW 3 107930826 critical splice donor site probably null
R7014:Gstm7 UTSW 3 107926962 missense probably benign 0.00
R7052:Gstm7 UTSW 3 107931317 missense probably damaging 0.96
R7741:Gstm7 UTSW 3 107931647 missense possibly damaging 0.90
R7848:Gstm7 UTSW 3 107928586 splice site probably null
R7988:Gstm7 UTSW 3 107926955 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GAGCAGCGCTAAGACGTTAG -3'
(R):5'- CATGCTTGTCCATTCAGCTG -3'

Sequencing Primer
(F):5'- CGCTAAGACGTTAGATGCTAAGC -3'
(R):5'- ACTTGATCGATGGGTCACAC -3'
Posted On2020-01-23