Incidental Mutation 'R7998:Olfr275'
ID616178
Institutional Source Beutler Lab
Gene Symbol Olfr275
Ensembl Gene ENSMUSG00000089717
Gene Nameolfactory receptor 275
SynonymsGA_x6K02T2N78B-7168533-7167574, MOR262-2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_146858.2; MGI: 3030109

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location52814604-52828269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52825970 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 191 (D191V)
Ref Sequence ENSEMBL: ENSMUSP00000092700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095085]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095085
AA Change: D191V

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092700
Gene: ENSMUSG00000089717
AA Change: D191V

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 9.8e-54 PFAM
Pfam:7tm_1 41 290 6.2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Olfr275
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Olfr275 APN 4 52825727 missense probably damaging 1.00
IGL01758:Olfr275 APN 4 52825468 nonsense probably null
IGL01925:Olfr275 APN 4 52825910 missense probably benign 0.00
IGL02525:Olfr275 APN 4 52825616 missense probably damaging 1.00
IGL02536:Olfr275 APN 4 52825817 missense possibly damaging 0.95
IGL02829:Olfr275 APN 4 52826027 missense probably damaging 0.98
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0068:Olfr275 UTSW 4 52825503 nonsense probably null
R0190:Olfr275 UTSW 4 52825613 missense probably damaging 0.97
R4376:Olfr275 UTSW 4 52826195 missense possibly damaging 0.81
R4617:Olfr275 UTSW 4 52825399 start codon destroyed probably benign 0.35
R4658:Olfr275 UTSW 4 52826240 missense probably damaging 0.99
R4828:Olfr275 UTSW 4 52826138 missense probably damaging 1.00
R4850:Olfr275 UTSW 4 52825450 missense possibly damaging 0.94
R6194:Olfr275 UTSW 4 52825779 nonsense probably null
R6401:Olfr275 UTSW 4 52826242 missense probably damaging 1.00
R6842:Olfr275 UTSW 4 52825576 missense probably damaging 1.00
R7033:Olfr275 UTSW 4 52826089 missense probably benign
R8101:Olfr275 UTSW 4 52825849 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCATCTGTAACCCACTGAG -3'
(R):5'- TGGAGAGAGCTGTCCCATAG -3'

Sequencing Primer
(F):5'- GCCATCTGTAACCCACTGAGATATC -3'
(R):5'- GAGAGCTGTCCCATAGAACAG -3'
Posted On2020-01-23