Incidental Mutation 'R7998:Mier1'
ID616179
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene NameMEIR1 treanscription regulator
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location103114390-103165754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103162615 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 512 (F512S)
Ref Sequence ENSEMBL: ENSMUSP00000095558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
Predicted Effect probably benign
Transcript: ENSMUST00000030247
AA Change: F484S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: F484S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097945
AA Change: F512S

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: F512S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
AA Change: F286S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522
AA Change: F286S

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106857
AA Change: F467S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: F467S

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106858
AA Change: F484S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: F484S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103155572 missense probably damaging 0.99
IGL01599:Mier1 APN 4 103155541 missense possibly damaging 0.58
IGL01996:Mier1 APN 4 103127276 missense possibly damaging 0.93
IGL02228:Mier1 APN 4 103131062 missense possibly damaging 0.85
R0194:Mier1 UTSW 4 103139519 splice site probably null
R0505:Mier1 UTSW 4 103155623 splice site probably benign
R0684:Mier1 UTSW 4 103139434 missense probably damaging 0.99
R0691:Mier1 UTSW 4 103139502 missense probably benign 0.07
R2997:Mier1 UTSW 4 103131036 missense probably damaging 1.00
R4273:Mier1 UTSW 4 103162431 missense possibly damaging 0.93
R4728:Mier1 UTSW 4 103140205 missense probably damaging 1.00
R4769:Mier1 UTSW 4 103140220 missense probably benign 0.01
R4798:Mier1 UTSW 4 103130998 missense probably damaging 1.00
R5075:Mier1 UTSW 4 103139473 missense probably benign 0.02
R5260:Mier1 UTSW 4 103162710 missense probably benign 0.04
R5663:Mier1 UTSW 4 103150542 missense probably damaging 0.96
R5924:Mier1 UTSW 4 103159702 nonsense probably null
R7253:Mier1 UTSW 4 103139347 splice site probably null
R7304:Mier1 UTSW 4 103139402 nonsense probably null
R7641:Mier1 UTSW 4 103139440 missense possibly damaging 0.89
R8000:Mier1 UTSW 4 103131043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCTAATGGACCAGGAGAAATAC -3'
(R):5'- TCAGCTTTCTAAAGGTCACCCC -3'

Sequencing Primer
(F):5'- CTAATGGACCAGGAGAAATACTAAAC -3'
(R):5'- GTAGTCAAACCAGACTTTACTGC -3'
Posted On2020-01-23