Incidental Mutation 'R7998:Npffr2'
ID 616184
Institutional Source Beutler Lab
Gene Symbol Npffr2
Ensembl Gene ENSMUSG00000035528
Gene Name neuropeptide FF receptor 2
Synonyms Gpr74, NPFF2
MMRRC Submission 046038-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 89675288-89731599 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89731149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 360 (Y360H)
Ref Sequence ENSEMBL: ENSMUSP00000040033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048557]
AlphaFold Q924H0
Predicted Effect probably damaging
Transcript: ENSMUST00000048557
AA Change: Y360H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040033
Gene: ENSMUSG00000035528
AA Change: Y360H

DomainStartEndE-ValueType
Pfam:7tm_4 52 349 3.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 56 347 3.7e-11 PFAM
Pfam:7tm_1 62 332 4.2e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 35,818,649 (GRCm39) R216C probably benign Het
Acsl3 C T 1: 78,671,988 (GRCm39) P294L probably damaging Het
Alox12b T C 11: 69,059,663 (GRCm39) Y572H probably damaging Het
Arid1b A G 17: 5,377,959 (GRCm39) D1236G probably damaging Het
Astl T C 2: 127,192,419 (GRCm39) L254P probably damaging Het
Btbd7 A C 12: 102,761,499 (GRCm39) L562R probably damaging Het
Chl1 T C 6: 103,706,250 (GRCm39) V1195A probably benign Het
Ciao2b T A 8: 105,367,668 (GRCm39) S94C probably damaging Het
Cib1 A T 7: 79,878,162 (GRCm39) Y105* probably null Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Cpne6 A C 14: 55,753,751 (GRCm39) Q403P probably damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dicer1 A T 12: 104,670,328 (GRCm39) F1079Y probably damaging Het
Dsc2 T A 18: 20,167,720 (GRCm39) Q724H possibly damaging Het
Fbxw16 A G 9: 109,265,766 (GRCm39) V351A probably damaging Het
G2e3 A T 12: 51,400,624 (GRCm39) E59D probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm10837 G T 14: 122,728,053 (GRCm39) probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr18 T C 14: 122,149,393 (GRCm39) I211V probably benign Het
Gstm7 T A 3: 107,837,657 (GRCm39) D98V probably damaging Het
Hspa8 A G 9: 40,715,810 (GRCm39) Y525C probably damaging Het
Itga7 T C 10: 128,770,020 (GRCm39) S55P probably damaging Het
Itpr1 T C 6: 108,394,909 (GRCm39) V1674A possibly damaging Het
Itsn1 G T 16: 91,647,824 (GRCm39) G893C unknown Het
Kcnc1 A G 7: 46,047,223 (GRCm39) D41G probably benign Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Leo1 G T 9: 75,352,558 (GRCm39) G34C probably benign Het
Map4 G A 9: 109,908,929 (GRCm39) V1050M probably damaging Het
Mast3 A G 8: 71,236,214 (GRCm39) V722A probably benign Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mier1 T C 4: 103,019,812 (GRCm39) F512S probably benign Het
Mix23 T A 16: 35,905,403 (GRCm39) V65D probably benign Het
Mov10l1 T A 15: 88,937,642 (GRCm39) V1147E probably damaging Het
Mroh7 T C 4: 106,568,478 (GRCm39) E409G probably benign Het
Muc16 G T 9: 18,551,188 (GRCm39) P5035Q probably benign Het
Nemp1 C A 10: 127,529,358 (GRCm39) S213R probably damaging Het
Nrxn2 T C 19: 6,559,905 (GRCm39) V1221A probably damaging Het
Nup107 A G 10: 117,593,899 (GRCm39) F765L probably damaging Het
Nup188 T C 2: 30,220,983 (GRCm39) L991P probably damaging Het
Or13f5 A T 4: 52,825,970 (GRCm39) D191V possibly damaging Het
Or5ac23 T A 16: 59,149,633 (GRCm39) M80L probably benign Het
Pla2g7 A T 17: 43,922,209 (GRCm39) I363L probably benign Het
Ppp2r1a T C 17: 21,181,901 (GRCm39) F473S possibly damaging Het
Prex1 A G 2: 166,428,965 (GRCm39) probably null Het
Ptov1 A G 7: 44,514,353 (GRCm39) V263A probably damaging Het
Reg3a T C 6: 78,358,132 (GRCm39) V21A probably benign Het
Sdk2 T A 11: 113,750,764 (GRCm39) I550F probably benign Het
Shprh T A 10: 11,061,085 (GRCm39) W1133R probably damaging Het
Slc28a2b T C 2: 122,324,839 (GRCm39) L137P probably damaging Het
Syne2 T C 12: 76,134,632 (GRCm39) V1297A probably damaging Het
Themis2 A G 4: 132,519,875 (GRCm39) I50T probably damaging Het
Tmprss15 C A 16: 78,798,731 (GRCm39) L650F possibly damaging Het
Ttc41 C A 10: 86,572,711 (GRCm39) N694K probably benign Het
Ttll9 T C 2: 152,833,546 (GRCm39) Y215H possibly damaging Het
Ttn C A 2: 76,733,653 (GRCm39) V4541L unknown Het
Usp32 G T 11: 84,885,252 (GRCm39) A1265E probably damaging Het
Vcan T A 13: 89,852,446 (GRCm39) D838V probably damaging Het
Vmn2r88 T C 14: 51,651,565 (GRCm39) I293T Het
Wdr36 T G 18: 32,985,572 (GRCm39) D496E probably damaging Het
Wrn T C 8: 33,782,671 (GRCm39) N753S probably benign Het
Zmat3 T C 3: 32,395,815 (GRCm39) R231G possibly damaging Het
Other mutations in Npffr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Npffr2 APN 5 89,730,831 (GRCm39) missense probably benign
IGL02308:Npffr2 APN 5 89,731,310 (GRCm39) missense probably benign 0.00
IGL02455:Npffr2 APN 5 89,715,994 (GRCm39) missense probably damaging 1.00
IGL03288:Npffr2 APN 5 89,731,020 (GRCm39) missense probably damaging 1.00
R0309:Npffr2 UTSW 5 89,731,206 (GRCm39) missense probably benign 0.00
R0389:Npffr2 UTSW 5 89,730,613 (GRCm39) missense probably benign 0.15
R1552:Npffr2 UTSW 5 89,730,975 (GRCm39) missense possibly damaging 0.45
R1736:Npffr2 UTSW 5 89,715,925 (GRCm39) missense probably damaging 1.00
R2015:Npffr2 UTSW 5 89,730,751 (GRCm39) missense probably damaging 0.99
R2127:Npffr2 UTSW 5 89,715,924 (GRCm39) missense probably damaging 1.00
R2129:Npffr2 UTSW 5 89,715,924 (GRCm39) missense probably damaging 1.00
R2429:Npffr2 UTSW 5 89,731,006 (GRCm39) missense probably damaging 1.00
R4272:Npffr2 UTSW 5 89,715,882 (GRCm39) missense probably damaging 1.00
R4740:Npffr2 UTSW 5 89,730,879 (GRCm39) nonsense probably null
R5023:Npffr2 UTSW 5 89,730,546 (GRCm39) missense probably benign 0.07
R6386:Npffr2 UTSW 5 89,730,556 (GRCm39) missense probably benign 0.02
R6546:Npffr2 UTSW 5 89,730,871 (GRCm39) missense probably damaging 1.00
R7735:Npffr2 UTSW 5 89,731,173 (GRCm39) missense probably benign
R7953:Npffr2 UTSW 5 89,730,513 (GRCm39) missense probably benign 0.24
R8043:Npffr2 UTSW 5 89,730,513 (GRCm39) missense probably benign 0.24
R8509:Npffr2 UTSW 5 89,731,188 (GRCm39) missense possibly damaging 0.78
R8799:Npffr2 UTSW 5 89,731,177 (GRCm39) missense probably benign 0.00
R9327:Npffr2 UTSW 5 89,730,661 (GRCm39) missense probably benign
X0039:Npffr2 UTSW 5 89,731,146 (GRCm39) missense probably benign 0.16
X0063:Npffr2 UTSW 5 89,715,844 (GRCm39) missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- GCTCTCAGACTATACTGACCTGTC -3'
(R):5'- TATGGCATCAGGTAGCACTGG -3'

Sequencing Primer
(F):5'- TGACCTGTCTCCTAACAAACTGCG -3'
(R):5'- GGGGTCCACACGATCTTTTTAAGC -3'
Posted On 2020-01-23