Incidental Mutation 'R7998:Cib1'
ID616191
Institutional Source Beutler Lab
Gene Symbol Cib1
Ensembl Gene ENSMUSG00000030538
Gene Namecalcium and integrin binding 1 (calmyrin)
SynonymsKip
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location80227147-80232813 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 80228414 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 105 (Y105*)
Ref Sequence ENSEMBL: ENSMUSP00000145961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032754] [ENSMUST00000062915] [ENSMUST00000065163] [ENSMUST00000071457] [ENSMUST00000123279] [ENSMUST00000205822] [ENSMUST00000205996] [ENSMUST00000206084] [ENSMUST00000206802]
Predicted Effect probably benign
Transcript: ENSMUST00000032754
SMART Domains Protein: ENSMUSP00000032754
Gene: ENSMUSG00000030539

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Sema 57 494 8.07e-177 SMART
PSI 512 582 4.7e-9 SMART
low complexity region 626 639 N/A INTRINSIC
transmembrane domain 701 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062915
SMART Domains Protein: ENSMUSP00000061808
Gene: ENSMUSG00000050973

DomainStartEndE-ValueType
SCOP:d1kpf__ 150 223 1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065163
AA Change: Y110*
SMART Domains Protein: ENSMUSP00000070901
Gene: ENSMUSG00000030538
AA Change: Y110*

DomainStartEndE-ValueType
low complexity region 84 100 N/A INTRINSIC
EFh 107 135 4.4e0 SMART
EFh 152 180 1.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000071457
AA Change: Y62*
SMART Domains Protein: ENSMUSP00000071401
Gene: ENSMUSG00000030538
AA Change: Y62*

DomainStartEndE-ValueType
low complexity region 36 52 N/A INTRINSIC
EFh 59 87 4.4e0 SMART
EFh 104 132 1.17e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000123279
AA Change: Y36*
SMART Domains Protein: ENSMUSP00000118926
Gene: ENSMUSG00000030538
AA Change: Y36*

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
EFh 33 61 4.4e0 SMART
EFh 78 106 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144295
Predicted Effect probably benign
Transcript: ENSMUST00000205822
Predicted Effect probably null
Transcript: ENSMUST00000205996
AA Change: Y36*
Predicted Effect probably null
Transcript: ENSMUST00000206084
AA Change: Y105*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206618
Predicted Effect probably benign
Transcript: ENSMUST00000206802
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EF-hand domain-containing calcium-binding superfamily. The encoded protein interacts with many other proteins, including the platelet integrin alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal adhesion kinase, p21 activated kinase, and protein kinase D. The encoded protein may be involved in cell survival and proliferation, and is associated with several disease states including cancer and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mutation of this gene results in male infertility due to disruption of the haploid phase of spermatogenesis and is associated with small testis size and loss of elongated spermatids and sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Cib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0042:Cib1 UTSW 7 80230378 missense probably benign 0.00
R1132:Cib1 UTSW 7 80228030 missense probably damaging 1.00
R1548:Cib1 UTSW 7 80228414 nonsense probably null
R1964:Cib1 UTSW 7 80232372 missense possibly damaging 0.90
R7203:Cib1 UTSW 7 80232372 missense possibly damaging 0.90
R8427:Cib1 UTSW 7 80228001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCTGCTTCATCTCAGAAG -3'
(R):5'- AGGTCATGCCCTGTGATGTTC -3'

Sequencing Primer
(F):5'- ATTCACAAGCTGGCTCAGGTC -3'
(R):5'- GTTCACAGAAGGCTTTCTTACACAGG -3'
Posted On2020-01-23