Incidental Mutation 'R7998:Wrn'
ID 616192
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 046038-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R7998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 33724412-33875555 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33782671 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 753 (N753S)
Ref Sequence ENSEMBL: ENSMUSP00000033990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
PDB Structure structure of mouse WRN exonuclease domain [X-RAY DIFFRACTION]
structure of mouse werner exonuclease domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033990
AA Change: N753S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: N753S

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
AA Change: N753S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: N753S

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211498
AA Change: N510S

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 35,818,649 (GRCm39) R216C probably benign Het
Acsl3 C T 1: 78,671,988 (GRCm39) P294L probably damaging Het
Alox12b T C 11: 69,059,663 (GRCm39) Y572H probably damaging Het
Arid1b A G 17: 5,377,959 (GRCm39) D1236G probably damaging Het
Astl T C 2: 127,192,419 (GRCm39) L254P probably damaging Het
Btbd7 A C 12: 102,761,499 (GRCm39) L562R probably damaging Het
Chl1 T C 6: 103,706,250 (GRCm39) V1195A probably benign Het
Ciao2b T A 8: 105,367,668 (GRCm39) S94C probably damaging Het
Cib1 A T 7: 79,878,162 (GRCm39) Y105* probably null Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Cpne6 A C 14: 55,753,751 (GRCm39) Q403P probably damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dicer1 A T 12: 104,670,328 (GRCm39) F1079Y probably damaging Het
Dsc2 T A 18: 20,167,720 (GRCm39) Q724H possibly damaging Het
Fbxw16 A G 9: 109,265,766 (GRCm39) V351A probably damaging Het
G2e3 A T 12: 51,400,624 (GRCm39) E59D probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm10837 G T 14: 122,728,053 (GRCm39) probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr18 T C 14: 122,149,393 (GRCm39) I211V probably benign Het
Gstm7 T A 3: 107,837,657 (GRCm39) D98V probably damaging Het
Hspa8 A G 9: 40,715,810 (GRCm39) Y525C probably damaging Het
Itga7 T C 10: 128,770,020 (GRCm39) S55P probably damaging Het
Itpr1 T C 6: 108,394,909 (GRCm39) V1674A possibly damaging Het
Itsn1 G T 16: 91,647,824 (GRCm39) G893C unknown Het
Kcnc1 A G 7: 46,047,223 (GRCm39) D41G probably benign Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Leo1 G T 9: 75,352,558 (GRCm39) G34C probably benign Het
Map4 G A 9: 109,908,929 (GRCm39) V1050M probably damaging Het
Mast3 A G 8: 71,236,214 (GRCm39) V722A probably benign Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mier1 T C 4: 103,019,812 (GRCm39) F512S probably benign Het
Mix23 T A 16: 35,905,403 (GRCm39) V65D probably benign Het
Mov10l1 T A 15: 88,937,642 (GRCm39) V1147E probably damaging Het
Mroh7 T C 4: 106,568,478 (GRCm39) E409G probably benign Het
Muc16 G T 9: 18,551,188 (GRCm39) P5035Q probably benign Het
Nemp1 C A 10: 127,529,358 (GRCm39) S213R probably damaging Het
Npffr2 T C 5: 89,731,149 (GRCm39) Y360H probably damaging Het
Nrxn2 T C 19: 6,559,905 (GRCm39) V1221A probably damaging Het
Nup107 A G 10: 117,593,899 (GRCm39) F765L probably damaging Het
Nup188 T C 2: 30,220,983 (GRCm39) L991P probably damaging Het
Or13f5 A T 4: 52,825,970 (GRCm39) D191V possibly damaging Het
Or5ac23 T A 16: 59,149,633 (GRCm39) M80L probably benign Het
Pla2g7 A T 17: 43,922,209 (GRCm39) I363L probably benign Het
Ppp2r1a T C 17: 21,181,901 (GRCm39) F473S possibly damaging Het
Prex1 A G 2: 166,428,965 (GRCm39) probably null Het
Ptov1 A G 7: 44,514,353 (GRCm39) V263A probably damaging Het
Reg3a T C 6: 78,358,132 (GRCm39) V21A probably benign Het
Sdk2 T A 11: 113,750,764 (GRCm39) I550F probably benign Het
Shprh T A 10: 11,061,085 (GRCm39) W1133R probably damaging Het
Slc28a2b T C 2: 122,324,839 (GRCm39) L137P probably damaging Het
Syne2 T C 12: 76,134,632 (GRCm39) V1297A probably damaging Het
Themis2 A G 4: 132,519,875 (GRCm39) I50T probably damaging Het
Tmprss15 C A 16: 78,798,731 (GRCm39) L650F possibly damaging Het
Ttc41 C A 10: 86,572,711 (GRCm39) N694K probably benign Het
Ttll9 T C 2: 152,833,546 (GRCm39) Y215H possibly damaging Het
Ttn C A 2: 76,733,653 (GRCm39) V4541L unknown Het
Usp32 G T 11: 84,885,252 (GRCm39) A1265E probably damaging Het
Vcan T A 13: 89,852,446 (GRCm39) D838V probably damaging Het
Vmn2r88 T C 14: 51,651,565 (GRCm39) I293T Het
Wdr36 T G 18: 32,985,572 (GRCm39) D496E probably damaging Het
Zmat3 T C 3: 32,395,815 (GRCm39) R231G possibly damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33,812,405 (GRCm39) splice site probably benign
IGL00661:Wrn APN 8 33,809,173 (GRCm39) splice site probably benign
IGL01472:Wrn APN 8 33,819,200 (GRCm39) missense possibly damaging 0.93
IGL01544:Wrn APN 8 33,814,554 (GRCm39) missense probably benign 0.00
IGL01599:Wrn APN 8 33,731,039 (GRCm39) missense possibly damaging 0.69
IGL01688:Wrn APN 8 33,800,730 (GRCm39) splice site probably benign
IGL01916:Wrn APN 8 33,747,252 (GRCm39) missense possibly damaging 0.78
IGL01925:Wrn APN 8 33,809,208 (GRCm39) missense probably benign 0.42
IGL02068:Wrn APN 8 33,800,777 (GRCm39) missense probably benign 0.38
IGL02084:Wrn APN 8 33,775,207 (GRCm39) missense probably benign
IGL02167:Wrn APN 8 33,807,583 (GRCm39) missense probably damaging 1.00
IGL02230:Wrn APN 8 33,807,591 (GRCm39) missense probably damaging 1.00
IGL02717:Wrn APN 8 33,833,601 (GRCm39) missense probably damaging 1.00
IGL02982:Wrn APN 8 33,833,094 (GRCm39) missense probably damaging 1.00
IGL03030:Wrn APN 8 33,738,989 (GRCm39) missense possibly damaging 0.94
IGL03088:Wrn APN 8 33,758,851 (GRCm39) splice site probably benign
IGL03179:Wrn APN 8 33,800,734 (GRCm39) splice site probably null
IGL03306:Wrn APN 8 33,826,149 (GRCm39) missense probably damaging 1.00
R0004:Wrn UTSW 8 33,807,588 (GRCm39) missense probably damaging 1.00
R0190:Wrn UTSW 8 33,731,011 (GRCm39) missense probably benign 0.02
R0441:Wrn UTSW 8 33,758,778 (GRCm39) missense probably benign 0.24
R0463:Wrn UTSW 8 33,770,843 (GRCm39) missense possibly damaging 0.84
R0538:Wrn UTSW 8 33,826,119 (GRCm39) missense probably damaging 0.99
R0682:Wrn UTSW 8 33,757,848 (GRCm39) missense probably benign 0.00
R0729:Wrn UTSW 8 33,738,946 (GRCm39) splice site probably null
R0744:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R0836:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R1168:Wrn UTSW 8 33,806,436 (GRCm39) missense probably damaging 1.00
R1301:Wrn UTSW 8 33,782,714 (GRCm39) missense probably damaging 1.00
R1352:Wrn UTSW 8 33,784,944 (GRCm39) missense probably benign 0.25
R1396:Wrn UTSW 8 33,758,847 (GRCm39) missense probably damaging 1.00
R1432:Wrn UTSW 8 33,809,169 (GRCm39) splice site probably benign
R1523:Wrn UTSW 8 33,782,744 (GRCm39) missense probably benign 0.23
R1625:Wrn UTSW 8 33,819,158 (GRCm39) missense probably benign 0.01
R1664:Wrn UTSW 8 33,770,794 (GRCm39) splice site probably null
R1773:Wrn UTSW 8 33,833,589 (GRCm39) missense probably damaging 1.00
R1864:Wrn UTSW 8 33,778,892 (GRCm39) missense probably damaging 0.99
R1868:Wrn UTSW 8 33,747,249 (GRCm39) missense probably benign 0.03
R2011:Wrn UTSW 8 33,726,432 (GRCm39) missense probably benign 0.02
R2075:Wrn UTSW 8 33,812,357 (GRCm39) missense probably benign 0.00
R2091:Wrn UTSW 8 33,757,853 (GRCm39) missense probably benign
R2213:Wrn UTSW 8 33,747,043 (GRCm39) missense probably benign 0.05
R2255:Wrn UTSW 8 33,819,230 (GRCm39) missense probably benign 0.13
R2276:Wrn UTSW 8 33,814,584 (GRCm39) missense probably benign 0.02
R3177:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3277:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3779:Wrn UTSW 8 33,731,048 (GRCm39) missense probably damaging 1.00
R3827:Wrn UTSW 8 33,814,548 (GRCm39) missense probably benign 0.00
R4111:Wrn UTSW 8 33,842,183 (GRCm39) missense probably benign 0.02
R4392:Wrn UTSW 8 33,741,860 (GRCm39) missense probably damaging 0.99
R4458:Wrn UTSW 8 33,785,026 (GRCm39) missense probably damaging 0.99
R4650:Wrn UTSW 8 33,745,537 (GRCm39) missense probably benign 0.05
R4656:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4657:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4667:Wrn UTSW 8 33,814,366 (GRCm39) missense probably benign 0.00
R4735:Wrn UTSW 8 33,775,250 (GRCm39) missense probably damaging 1.00
R4933:Wrn UTSW 8 33,812,371 (GRCm39) missense probably benign 0.01
R5104:Wrn UTSW 8 33,757,895 (GRCm39) splice site probably null
R5166:Wrn UTSW 8 33,842,100 (GRCm39) critical splice donor site probably null
R5279:Wrn UTSW 8 33,731,129 (GRCm39) missense probably damaging 1.00
R5400:Wrn UTSW 8 33,784,945 (GRCm39) missense probably benign 0.02
R5575:Wrn UTSW 8 33,826,158 (GRCm39) missense probably benign 0.02
R5695:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.26
R5729:Wrn UTSW 8 33,758,806 (GRCm39) missense probably benign 0.02
R6044:Wrn UTSW 8 33,726,457 (GRCm39) missense probably damaging 1.00
R6139:Wrn UTSW 8 33,843,360 (GRCm39) missense probably damaging 1.00
R6158:Wrn UTSW 8 33,809,200 (GRCm39) missense probably damaging 1.00
R6192:Wrn UTSW 8 33,774,682 (GRCm39) missense probably benign 0.12
R6243:Wrn UTSW 8 33,774,682 (GRCm39) missense possibly damaging 0.94
R6354:Wrn UTSW 8 33,833,666 (GRCm39) missense possibly damaging 0.93
R6429:Wrn UTSW 8 33,833,024 (GRCm39) missense probably damaging 1.00
R6490:Wrn UTSW 8 33,809,248 (GRCm39) missense probably benign 0.01
R6529:Wrn UTSW 8 33,826,004 (GRCm39) splice site probably null
R6535:Wrn UTSW 8 33,826,131 (GRCm39) missense probably damaging 0.99
R7001:Wrn UTSW 8 33,842,157 (GRCm39) missense probably benign 0.04
R7114:Wrn UTSW 8 33,775,149 (GRCm39) frame shift probably null
R7198:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.00
R7200:Wrn UTSW 8 33,812,376 (GRCm39) missense probably benign 0.00
R7227:Wrn UTSW 8 33,738,974 (GRCm39) missense probably damaging 1.00
R7299:Wrn UTSW 8 33,782,746 (GRCm39) missense probably damaging 1.00
R7374:Wrn UTSW 8 33,758,939 (GRCm39) missense probably damaging 1.00
R7402:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7404:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7405:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7464:Wrn UTSW 8 33,826,024 (GRCm39) critical splice donor site probably null
R7474:Wrn UTSW 8 33,819,209 (GRCm39) missense probably damaging 0.96
R7609:Wrn UTSW 8 33,800,741 (GRCm39) missense possibly damaging 0.50
R7729:Wrn UTSW 8 33,814,454 (GRCm39) missense probably benign 0.21
R7830:Wrn UTSW 8 33,759,082 (GRCm39) missense probably damaging 0.97
R8239:Wrn UTSW 8 33,819,213 (GRCm39) missense probably damaging 1.00
R8262:Wrn UTSW 8 33,814,274 (GRCm39) missense probably benign 0.07
R8410:Wrn UTSW 8 33,759,048 (GRCm39) missense probably damaging 1.00
R8480:Wrn UTSW 8 33,778,796 (GRCm39) missense probably benign 0.10
R8530:Wrn UTSW 8 33,770,852 (GRCm39) missense possibly damaging 0.83
R8540:Wrn UTSW 8 33,842,154 (GRCm39) missense probably damaging 0.96
R8708:Wrn UTSW 8 33,782,671 (GRCm39) missense probably damaging 0.96
R8783:Wrn UTSW 8 33,826,041 (GRCm39) missense probably null 1.00
R8870:Wrn UTSW 8 33,819,220 (GRCm39) missense probably benign 0.01
R8876:Wrn UTSW 8 33,814,422 (GRCm39) missense probably benign 0.00
R9050:Wrn UTSW 8 33,833,021 (GRCm39) missense probably damaging 1.00
R9329:Wrn UTSW 8 33,731,006 (GRCm39) missense probably benign
R9595:Wrn UTSW 8 33,758,961 (GRCm39) missense probably benign
R9621:Wrn UTSW 8 33,814,301 (GRCm39) missense probably benign 0.01
R9623:Wrn UTSW 8 33,774,644 (GRCm39) critical splice donor site probably null
R9797:Wrn UTSW 8 33,758,950 (GRCm39) missense probably benign 0.02
RF010:Wrn UTSW 8 33,778,793 (GRCm39) missense probably benign 0.13
X0017:Wrn UTSW 8 33,770,810 (GRCm39) missense probably damaging 1.00
Z1176:Wrn UTSW 8 33,824,237 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTCATTACCTTTATCAGAGTGGTG -3'
(R):5'- AAGATGAATCCCAAACTGCGATG -3'

Sequencing Primer
(F):5'- CCTTTATCAGAGTGGTGAAACTG -3'
(R):5'- CTGCGATGAAACATACATGTAACAG -3'
Posted On 2020-01-23