Incidental Mutation 'R7998:Mast3'
ID 616193
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 046038-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71236214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 722 (V722A)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000166004
AA Change: V738A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: V738A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211948
AA Change: V722A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 35,818,649 (GRCm39) R216C probably benign Het
Acsl3 C T 1: 78,671,988 (GRCm39) P294L probably damaging Het
Alox12b T C 11: 69,059,663 (GRCm39) Y572H probably damaging Het
Arid1b A G 17: 5,377,959 (GRCm39) D1236G probably damaging Het
Astl T C 2: 127,192,419 (GRCm39) L254P probably damaging Het
Btbd7 A C 12: 102,761,499 (GRCm39) L562R probably damaging Het
Chl1 T C 6: 103,706,250 (GRCm39) V1195A probably benign Het
Ciao2b T A 8: 105,367,668 (GRCm39) S94C probably damaging Het
Cib1 A T 7: 79,878,162 (GRCm39) Y105* probably null Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Cpne6 A C 14: 55,753,751 (GRCm39) Q403P probably damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dicer1 A T 12: 104,670,328 (GRCm39) F1079Y probably damaging Het
Dsc2 T A 18: 20,167,720 (GRCm39) Q724H possibly damaging Het
Fbxw16 A G 9: 109,265,766 (GRCm39) V351A probably damaging Het
G2e3 A T 12: 51,400,624 (GRCm39) E59D probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm10837 G T 14: 122,728,053 (GRCm39) probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr18 T C 14: 122,149,393 (GRCm39) I211V probably benign Het
Gstm7 T A 3: 107,837,657 (GRCm39) D98V probably damaging Het
Hspa8 A G 9: 40,715,810 (GRCm39) Y525C probably damaging Het
Itga7 T C 10: 128,770,020 (GRCm39) S55P probably damaging Het
Itpr1 T C 6: 108,394,909 (GRCm39) V1674A possibly damaging Het
Itsn1 G T 16: 91,647,824 (GRCm39) G893C unknown Het
Kcnc1 A G 7: 46,047,223 (GRCm39) D41G probably benign Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Leo1 G T 9: 75,352,558 (GRCm39) G34C probably benign Het
Map4 G A 9: 109,908,929 (GRCm39) V1050M probably damaging Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mier1 T C 4: 103,019,812 (GRCm39) F512S probably benign Het
Mix23 T A 16: 35,905,403 (GRCm39) V65D probably benign Het
Mov10l1 T A 15: 88,937,642 (GRCm39) V1147E probably damaging Het
Mroh7 T C 4: 106,568,478 (GRCm39) E409G probably benign Het
Muc16 G T 9: 18,551,188 (GRCm39) P5035Q probably benign Het
Nemp1 C A 10: 127,529,358 (GRCm39) S213R probably damaging Het
Npffr2 T C 5: 89,731,149 (GRCm39) Y360H probably damaging Het
Nrxn2 T C 19: 6,559,905 (GRCm39) V1221A probably damaging Het
Nup107 A G 10: 117,593,899 (GRCm39) F765L probably damaging Het
Nup188 T C 2: 30,220,983 (GRCm39) L991P probably damaging Het
Or13f5 A T 4: 52,825,970 (GRCm39) D191V possibly damaging Het
Or5ac23 T A 16: 59,149,633 (GRCm39) M80L probably benign Het
Pla2g7 A T 17: 43,922,209 (GRCm39) I363L probably benign Het
Ppp2r1a T C 17: 21,181,901 (GRCm39) F473S possibly damaging Het
Prex1 A G 2: 166,428,965 (GRCm39) probably null Het
Ptov1 A G 7: 44,514,353 (GRCm39) V263A probably damaging Het
Reg3a T C 6: 78,358,132 (GRCm39) V21A probably benign Het
Sdk2 T A 11: 113,750,764 (GRCm39) I550F probably benign Het
Shprh T A 10: 11,061,085 (GRCm39) W1133R probably damaging Het
Slc28a2b T C 2: 122,324,839 (GRCm39) L137P probably damaging Het
Syne2 T C 12: 76,134,632 (GRCm39) V1297A probably damaging Het
Themis2 A G 4: 132,519,875 (GRCm39) I50T probably damaging Het
Tmprss15 C A 16: 78,798,731 (GRCm39) L650F possibly damaging Het
Ttc41 C A 10: 86,572,711 (GRCm39) N694K probably benign Het
Ttll9 T C 2: 152,833,546 (GRCm39) Y215H possibly damaging Het
Ttn C A 2: 76,733,653 (GRCm39) V4541L unknown Het
Usp32 G T 11: 84,885,252 (GRCm39) A1265E probably damaging Het
Vcan T A 13: 89,852,446 (GRCm39) D838V probably damaging Het
Vmn2r88 T C 14: 51,651,565 (GRCm39) I293T Het
Wdr36 T G 18: 32,985,572 (GRCm39) D496E probably damaging Het
Wrn T C 8: 33,782,671 (GRCm39) N753S probably benign Het
Zmat3 T C 3: 32,395,815 (GRCm39) R231G possibly damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGTTATGGAGCACAGCGG -3'
(R):5'- TGTAACTGAGCAGGACAGCC -3'

Sequencing Primer
(F):5'- CCACTGTGTCTTAGGAATATGAAGCC -3'
(R):5'- AGTCCTCCACGGAGATCC -3'
Posted On 2020-01-23