Incidental Mutation 'R7998:Muc16'
ID616195
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18639892 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 5035 (P5035Q)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208663
AA Change: P5035Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6919:Muc16 UTSW 9 18660299 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGCAAAGTTGAAGTCATTGTG -3'
(R):5'- ATCAGTCGGGTCTACTCTCC -3'

Sequencing Primer
(F):5'- GTTGCTTTCTGTGCCTAAGTCACTG -3'
(R):5'- TCTCCCTTTTTCTTCAGGTAAAATAG -3'
Posted On2020-01-23