Mutagenetix > Incidental Mutations

Incidental Mutation 'R7998:Ttc41'

616202

Institutional Source

Beutler Lab

Gene Symbol

Ttc41

Ensembl Gene

ENSMUSG00000044937

Gene Name

tetratricopeptide repeat domain 41

Synonyms

Gnn, BC030307

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R7998 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

86705811-86776844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 86736847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 694 (N694K)

Ref Sequence

ENSEMBL: ENSMUSP00000075059 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075632]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075632
AA Change: N694K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: N694K

Domain	Start	End	E-Value	Type
low complexity region	216	229	N/A	INTRINSIC
low complexity region	307	315	N/A	INTRINSIC
Pfam:NACHT	337	515	5.4e-10	PFAM
SCOP:d1qqea_	805	1028	2e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000219476

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	C	T	14: 36,096,692	R216C	probably benign	Het
Acsl3	C	T	1: 78,694,271	P294L	probably damaging	Het
Alox12b	T	C	11: 69,168,837	Y572H	probably damaging	Het
Arid1b	A	G	17: 5,327,684	D1236G	probably damaging	Het
Astl	T	C	2: 127,350,499	L254P	probably damaging	Het
Btbd7	A	C	12: 102,795,240	L562R	probably damaging	Het
Ccdc58	T	A	16: 36,085,033	V65D	probably benign	Het
Chl1	T	C	6: 103,729,289	V1195A	probably benign	Het
Cib1	A	T	7: 80,228,414	Y105*	probably null	Het
Cog3	G	T	14: 75,747,093	S94Y	possibly damaging	Het
Cpne6	A	C	14: 55,516,294	Q403P	probably damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Cux2	T	C	5: 121,868,585	D874G	possibly damaging	Het
Dicer1	A	T	12: 104,704,069	F1079Y	probably damaging	Het
Dsc2	T	A	18: 20,034,663	Q724H	possibly damaging	Het
Fam96b	T	A	8: 104,641,036	S94C	probably damaging	Het
Fbxw16	A	G	9: 109,436,698	V351A	probably damaging	Het
G2e3	A	T	12: 51,353,841	E59D	probably benign	Het
Gm10800	A	AC	2: 98,667,033		probably null	Het
Gm10837	G	T	14: 122,490,641		probably benign	Het
Gm14085	T	C	2: 122,494,358	L137P	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr18	T	C	14: 121,911,981	I211V	probably benign	Het
Gstm7	T	A	3: 107,930,341	D98V	probably damaging	Het
Hspa8	A	G	9: 40,804,514	Y525C	probably damaging	Het
Itga7	T	C	10: 128,934,151	S55P	probably damaging	Het
Itpr1	T	C	6: 108,417,948	V1674A	possibly damaging	Het
Itsn1	G	T	16: 91,850,936	G893C	unknown	Het
Kcnc1	A	G	7: 46,397,799	D41G	probably benign	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Leo1	G	T	9: 75,445,276	G34C	probably benign	Het
Map4	G	A	9: 110,079,861	V1050M	probably damaging	Het
Mast3	A	G	8: 70,783,570	V722A	probably benign	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mier1	T	C	4: 103,162,615	F512S	probably benign	Het
Mov10l1	T	A	15: 89,053,439	V1147E	probably damaging	Het
Mroh7	T	C	4: 106,711,281	E409G	probably benign	Het
Muc16	G	T	9: 18,639,892	P5035Q	probably benign	Het
Nemp1	C	A	10: 127,693,489	S213R	probably damaging	Het
Npffr2	T	C	5: 89,583,290	Y360H	probably damaging	Het
Nrxn2	T	C	19: 6,509,875	V1221A	probably damaging	Het
Nup107	A	G	10: 117,757,994	F765L	probably damaging	Het
Nup188	T	C	2: 30,330,971	L991P	probably damaging	Het
Olfr205	T	A	16: 59,329,270	M80L	probably benign	Het
Olfr275	A	T	4: 52,825,970	D191V	possibly damaging	Het
Pla2g7	A	T	17: 43,611,318	I363L	probably benign	Het
Ppp2r1a	T	C	17: 20,961,639	F473S	possibly damaging	Het
Prex1	A	G	2: 166,587,045		probably null	Het
Ptov1	A	G	7: 44,864,929	V263A	probably damaging	Het
Reg3a	T	C	6: 78,381,149	V21A	probably benign	Het
Sdk2	T	A	11: 113,859,938	I550F	probably benign	Het
Shprh	T	A	10: 11,185,341	W1133R	probably damaging	Het
Syne2	T	C	12: 76,087,858	V1297A	probably damaging	Het
Themis2	A	G	4: 132,792,564	I50T	probably damaging	Het
Tmprss15	C	A	16: 79,001,843	L650F	possibly damaging	Het
Ttll9	T	C	2: 152,991,626	Y215H	possibly damaging	Het
Ttn	C	A	2: 76,903,309	V4541L	unknown	Het
Usp32	G	T	11: 84,994,426	A1265E	probably damaging	Het
Vcan	T	A	13: 89,704,327	D838V	probably damaging	Het
Vmn2r88	T	C	14: 51,414,108	I293T		Het
Wdr36	T	G	18: 32,852,519	D496E	probably damaging	Het
Wrn	T	C	8: 33,292,643	N753S	probably benign	Het
Zmat3	T	C	3: 32,341,666	R231G	possibly damaging	Het

Other mutations in Ttc41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Ttc41	APN	10	86736933	missense	possibly damaging	0.71
IGL01373:Ttc41	APN	10	86775957	missense	possibly damaging	0.61
IGL01636:Ttc41	APN	10	86776678	missense	probably benign
IGL01707:Ttc41	APN	10	86776767	missense	probably damaging	1.00
IGL01814:Ttc41	APN	10	86731026	missense	probably damaging	0.98
IGL01845:Ttc41	APN	10	86776624	missense	probably benign	0.03
IGL01918:Ttc41	APN	10	86713190	missense	probably damaging	1.00
IGL02374:Ttc41	APN	10	86775951	missense	probably damaging	1.00
IGL02489:Ttc41	APN	10	86760914	nonsense	probably null
IGL02887:Ttc41	APN	10	86733654	missense	probably damaging	1.00
IGL03061:Ttc41	APN	10	86736857	missense	possibly damaging	0.65
IGL03077:Ttc41	APN	10	86758348	missense	probably damaging	1.00
IGL03210:Ttc41	APN	10	86724414	critical splice donor site	probably null
IGL03242:Ttc41	APN	10	86776819	makesense	probably null
IGL03307:Ttc41	APN	10	86744440	missense	possibly damaging	0.76
BB003:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
BB013:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
R0071:Ttc41	UTSW	10	86736846	missense	probably benign	0.01
R0071:Ttc41	UTSW	10	86736846	missense	probably benign	0.01
R0379:Ttc41	UTSW	10	86712977	missense	possibly damaging	0.65
R0384:Ttc41	UTSW	10	86763947	missense	probably damaging	1.00
R0545:Ttc41	UTSW	10	86759097	missense	probably benign	0.00
R1589:Ttc41	UTSW	10	86776390	missense	probably benign	0.01
R1599:Ttc41	UTSW	10	86776573	missense	probably benign	0.04
R1608:Ttc41	UTSW	10	86775993	missense	probably damaging	1.00
R1670:Ttc41	UTSW	10	86776252	missense	possibly damaging	0.93
R1938:Ttc41	UTSW	10	86776214	missense	probably benign
R2398:Ttc41	UTSW	10	86713386	missense	possibly damaging	0.91
R2401:Ttc41	UTSW	10	86724374	missense	probably benign	0.42
R3117:Ttc41	UTSW	10	86724320	missense	possibly damaging	0.62
R3119:Ttc41	UTSW	10	86724320	missense	possibly damaging	0.62
R4805:Ttc41	UTSW	10	86729798	missense	possibly damaging	0.62
R4840:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4841:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4842:Ttc41	UTSW	10	86731125	missense	probably benign	0.10
R4884:Ttc41	UTSW	10	86731018	missense	probably benign	0.00
R4885:Ttc41	UTSW	10	86759102	missense	possibly damaging	0.76
R4898:Ttc41	UTSW	10	86776192	missense	possibly damaging	0.80
R5067:Ttc41	UTSW	10	86744544	missense	probably damaging	0.96
R5253:Ttc41	UTSW	10	86730942	missense	probably benign	0.13
R5268:Ttc41	UTSW	10	86744478	missense	possibly damaging	0.76
R5297:Ttc41	UTSW	10	86776579	missense	probably benign	0.04
R5301:Ttc41	UTSW	10	86719520	missense	probably benign	0.00
R5425:Ttc41	UTSW	10	86776630	missense	probably damaging	0.96
R5567:Ttc41	UTSW	10	86760920	critical splice donor site	probably null
R5635:Ttc41	UTSW	10	86736977	missense	probably benign	0.09
R5752:Ttc41	UTSW	10	86758346	missense	probably benign	0.33
R5868:Ttc41	UTSW	10	86750264	missense	possibly damaging	0.70
R5948:Ttc41	UTSW	10	86713224	missense	probably damaging	1.00
R6116:Ttc41	UTSW	10	86759088	critical splice acceptor site	probably null
R6247:Ttc41	UTSW	10	86776663	missense	probably benign	0.00
R6260:Ttc41	UTSW	10	86731159	missense	probably benign	0.20
R6260:Ttc41	UTSW	10	86733707	missense	probably benign	0.32
R6276:Ttc41	UTSW	10	86744449	missense	probably benign	0.01
R6458:Ttc41	UTSW	10	86758270	missense	possibly damaging	0.45
R7170:Ttc41	UTSW	10	86713503	missense	probably benign	0.17
R7348:Ttc41	UTSW	10	86750348	nonsense	probably null
R7382:Ttc41	UTSW	10	86776510	missense	probably damaging	0.97
R7509:Ttc41	UTSW	10	86713432	missense	probably damaging	1.00
R7689:Ttc41	UTSW	10	86759224	missense	probably damaging	1.00
R7807:Ttc41	UTSW	10	86776631	missense	probably benign	0.02
R7926:Ttc41	UTSW	10	86776047	missense	probably benign	0.10
R8021:Ttc41	UTSW	10	86733714	missense	probably benign
R8059:Ttc41	UTSW	10	86712978	missense	probably benign	0.01
R8170:Ttc41	UTSW	10	86776166	missense	probably damaging	1.00
R8303:Ttc41	UTSW	10	86719630	missense	probably benign	0.06
R8375:Ttc41	UTSW	10	86763980	missense	probably damaging	0.97
R8383:Ttc41	UTSW	10	86719526	missense	probably benign	0.00
R8698:Ttc41	UTSW	10	86712977	missense	probably benign	0.00
R8773:Ttc41	UTSW	10	86729815	missense	probably benign	0.35
R8902:Ttc41	UTSW	10	86713001	missense	probably benign	0.06
R8985:Ttc41	UTSW	10	86731092	missense	possibly damaging	0.80
R8988:Ttc41	UTSW	10	86713735	missense	possibly damaging	0.88
R9007:Ttc41	UTSW	10	86733761	missense	probably damaging	1.00
R9137:Ttc41	UTSW	10	86776622	missense	probably benign	0.22
R9236:Ttc41	UTSW	10	86776730	missense	probably damaging	1.00
R9248:Ttc41	UTSW	10	86731249	missense	probably benign	0.00
R9287:Ttc41	UTSW	10	86763966	missense	probably benign	0.43
R9345:Ttc41	UTSW	10	86759225	missense	probably damaging	0.99
R9386:Ttc41	UTSW	10	86713026	missense	probably damaging	0.99
X0024:Ttc41	UTSW	10	86724250	missense	probably damaging	1.00
X0064:Ttc41	UTSW	10	86729797	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCAAAGATACAGAGTTTTGGGATTG -3'
(R):5'- TGAGCATGCTACTCAGAGAAGC -3'

Sequencing Primer
(F):5'- GTGTTTTCTTCCCTAATCATAGCAAC -3'
(R):5'- ACTCAGAGAAGCCTTGTTGC -3'

Posted On

2020-01-23