Incidental Mutation 'R7998:Ttc41'
ID 616202
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 046038-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R7998 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 86572711 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 694 (N694K)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: N694K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: N694K

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 35,818,649 (GRCm39) R216C probably benign Het
Acsl3 C T 1: 78,671,988 (GRCm39) P294L probably damaging Het
Alox12b T C 11: 69,059,663 (GRCm39) Y572H probably damaging Het
Arid1b A G 17: 5,377,959 (GRCm39) D1236G probably damaging Het
Astl T C 2: 127,192,419 (GRCm39) L254P probably damaging Het
Btbd7 A C 12: 102,761,499 (GRCm39) L562R probably damaging Het
Chl1 T C 6: 103,706,250 (GRCm39) V1195A probably benign Het
Ciao2b T A 8: 105,367,668 (GRCm39) S94C probably damaging Het
Cib1 A T 7: 79,878,162 (GRCm39) Y105* probably null Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Cpne6 A C 14: 55,753,751 (GRCm39) Q403P probably damaging Het
Csn1s1 A G 5: 87,822,087 (GRCm39) N119S possibly damaging Het
Cux2 T C 5: 122,006,648 (GRCm39) D874G possibly damaging Het
Dicer1 A T 12: 104,670,328 (GRCm39) F1079Y probably damaging Het
Dsc2 T A 18: 20,167,720 (GRCm39) Q724H possibly damaging Het
Fbxw16 A G 9: 109,265,766 (GRCm39) V351A probably damaging Het
G2e3 A T 12: 51,400,624 (GRCm39) E59D probably benign Het
Gm10800 A AC 2: 98,497,378 (GRCm39) probably null Het
Gm10837 G T 14: 122,728,053 (GRCm39) probably benign Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gpr18 T C 14: 122,149,393 (GRCm39) I211V probably benign Het
Gstm7 T A 3: 107,837,657 (GRCm39) D98V probably damaging Het
Hspa8 A G 9: 40,715,810 (GRCm39) Y525C probably damaging Het
Itga7 T C 10: 128,770,020 (GRCm39) S55P probably damaging Het
Itpr1 T C 6: 108,394,909 (GRCm39) V1674A possibly damaging Het
Itsn1 G T 16: 91,647,824 (GRCm39) G893C unknown Het
Kcnc1 A G 7: 46,047,223 (GRCm39) D41G probably benign Het
Larp6 A G 9: 60,631,638 (GRCm39) K137E probably damaging Het
Leo1 G T 9: 75,352,558 (GRCm39) G34C probably benign Het
Map4 G A 9: 109,908,929 (GRCm39) V1050M probably damaging Het
Mast3 A G 8: 71,236,214 (GRCm39) V722A probably benign Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mier1 T C 4: 103,019,812 (GRCm39) F512S probably benign Het
Mix23 T A 16: 35,905,403 (GRCm39) V65D probably benign Het
Mov10l1 T A 15: 88,937,642 (GRCm39) V1147E probably damaging Het
Mroh7 T C 4: 106,568,478 (GRCm39) E409G probably benign Het
Muc16 G T 9: 18,551,188 (GRCm39) P5035Q probably benign Het
Nemp1 C A 10: 127,529,358 (GRCm39) S213R probably damaging Het
Npffr2 T C 5: 89,731,149 (GRCm39) Y360H probably damaging Het
Nrxn2 T C 19: 6,559,905 (GRCm39) V1221A probably damaging Het
Nup107 A G 10: 117,593,899 (GRCm39) F765L probably damaging Het
Nup188 T C 2: 30,220,983 (GRCm39) L991P probably damaging Het
Or13f5 A T 4: 52,825,970 (GRCm39) D191V possibly damaging Het
Or5ac23 T A 16: 59,149,633 (GRCm39) M80L probably benign Het
Pla2g7 A T 17: 43,922,209 (GRCm39) I363L probably benign Het
Ppp2r1a T C 17: 21,181,901 (GRCm39) F473S possibly damaging Het
Prex1 A G 2: 166,428,965 (GRCm39) probably null Het
Ptov1 A G 7: 44,514,353 (GRCm39) V263A probably damaging Het
Reg3a T C 6: 78,358,132 (GRCm39) V21A probably benign Het
Sdk2 T A 11: 113,750,764 (GRCm39) I550F probably benign Het
Shprh T A 10: 11,061,085 (GRCm39) W1133R probably damaging Het
Slc28a2b T C 2: 122,324,839 (GRCm39) L137P probably damaging Het
Syne2 T C 12: 76,134,632 (GRCm39) V1297A probably damaging Het
Themis2 A G 4: 132,519,875 (GRCm39) I50T probably damaging Het
Tmprss15 C A 16: 78,798,731 (GRCm39) L650F possibly damaging Het
Ttll9 T C 2: 152,833,546 (GRCm39) Y215H possibly damaging Het
Ttn C A 2: 76,733,653 (GRCm39) V4541L unknown Het
Usp32 G T 11: 84,885,252 (GRCm39) A1265E probably damaging Het
Vcan T A 13: 89,852,446 (GRCm39) D838V probably damaging Het
Vmn2r88 T C 14: 51,651,565 (GRCm39) I293T Het
Wdr36 T G 18: 32,985,572 (GRCm39) D496E probably damaging Het
Wrn T C 8: 33,782,671 (GRCm39) N753S probably benign Het
Zmat3 T C 3: 32,395,815 (GRCm39) R231G possibly damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4841:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86,612,056 (GRCm39) missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86,596,784 (GRCm39) critical splice donor site probably null
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5752:Ttc41 UTSW 10 86,594,210 (GRCm39) missense probably benign 0.33
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6260:Ttc41 UTSW 10 86,567,023 (GRCm39) missense probably benign 0.20
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAAAGATACAGAGTTTTGGGATTG -3'
(R):5'- TGAGCATGCTACTCAGAGAAGC -3'

Sequencing Primer
(F):5'- GTGTTTTCTTCCCTAATCATAGCAAC -3'
(R):5'- ACTCAGAGAAGCCTTGTTGC -3'
Posted On 2020-01-23