Incidental Mutation 'R7998:Nemp1'
ID616204
Institutional Source Beutler Lab
Gene Symbol Nemp1
Ensembl Gene ENSMUSG00000040195
Gene Namenuclear envelope integral membrane protein 1
SynonymsTmem194
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location127666901-127701049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 127693489 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 213 (S213R)
Ref Sequence ENSEMBL: ENSMUSP00000045988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048099] [ENSMUST00000118612] [ENSMUST00000118728]
Predicted Effect probably damaging
Transcript: ENSMUST00000048099
AA Change: S213R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045988
Gene: ENSMUSG00000040195
AA Change: S213R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 150 396 1.2e-94 PFAM
low complexity region 416 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118612
AA Change: S213R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113337
Gene: ENSMUSG00000040195
AA Change: S213R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:DUF2215 149 325 4.2e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118728
AA Change: S164R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113473
Gene: ENSMUSG00000040195
AA Change: S164R

DomainStartEndE-ValueType
Pfam:DUF2215 100 348 7.2e-105 PFAM
low complexity region 367 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Nemp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Nemp1 APN 10 127692999 missense probably benign 0.02
Assassin UTSW 10 127689343 nonsense probably null
Brightside UTSW 10 127689450 splice site probably null
Cheery UTSW 10 127677198 missense possibly damaging 0.86
PIT4453001:Nemp1 UTSW 10 127696254 missense probably benign 0.00
R0815:Nemp1 UTSW 10 127693024 missense probably damaging 0.99
R1719:Nemp1 UTSW 10 127696248 missense probably damaging 1.00
R2007:Nemp1 UTSW 10 127693577 missense probably benign 0.02
R2042:Nemp1 UTSW 10 127696334 missense possibly damaging 0.46
R3938:Nemp1 UTSW 10 127695473 missense probably damaging 1.00
R4548:Nemp1 UTSW 10 127696344 missense probably benign 0.00
R4726:Nemp1 UTSW 10 127694593 missense probably benign 0.01
R4981:Nemp1 UTSW 10 127693530 missense probably damaging 1.00
R5048:Nemp1 UTSW 10 127690935 critical splice donor site probably null
R5784:Nemp1 UTSW 10 127677198 missense possibly damaging 0.86
R6073:Nemp1 UTSW 10 127689243 missense probably benign 0.01
R6171:Nemp1 UTSW 10 127689450 splice site probably null
R6294:Nemp1 UTSW 10 127694522 missense possibly damaging 0.87
R7249:Nemp1 UTSW 10 127693526 missense probably damaging 1.00
R7269:Nemp1 UTSW 10 127695476 missense probably damaging 1.00
R7316:Nemp1 UTSW 10 127689343 nonsense probably null
R7468:Nemp1 UTSW 10 127693054 missense possibly damaging 0.56
R8342:Nemp1 UTSW 10 127693029 missense probably benign 0.00
X0011:Nemp1 UTSW 10 127689311 nonsense probably null
Z1177:Nemp1 UTSW 10 127693519 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGGAACTGAAAGCCACTTTG -3'
(R):5'- CAAGGAGCATCTTCTCACAATC -3'

Sequencing Primer
(F):5'- GGGAACTGAAAGCCACTTTGTTTAG -3'
(R):5'- GGAGCATCTTCTCACAATCAAATC -3'
Posted On2020-01-23