Incidental Mutation 'R7998:G2e3'
ID616209
Institutional Source Beutler Lab
Gene Symbol G2e3
Ensembl Gene ENSMUSG00000035293
Gene NameG2/M-phase specific E3 ubiquitin ligase
Synonyms6030408C04Rik, D930034K21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.676) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location51348061-51376986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51353841 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 59 (E59D)
Ref Sequence ENSEMBL: ENSMUSP00000113270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054308] [ENSMUST00000119211] [ENSMUST00000121521]
Predicted Effect probably benign
Transcript: ENSMUST00000054308
AA Change: E59D

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054474
Gene: ENSMUSG00000035293
AA Change: E59D

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 1e-2 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 402 692 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119211
AA Change: E59D

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113270
Gene: ENSMUSG00000035293
AA Change: E59D

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 383 717 3.1e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121521
AA Change: E59D

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113191
Gene: ENSMUSG00000035293
AA Change: E59D

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 298 598 4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele that inactivates this gene die prior to implantation due to massive apoptosis which results in involution of the blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in G2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:G2e3 APN 12 51353798 critical splice acceptor site probably null
IGL00793:G2e3 APN 12 51367762 missense probably benign 0.00
IGL02222:G2e3 APN 12 51363233 missense probably damaging 1.00
IGL02335:G2e3 APN 12 51369158 missense probably benign 0.19
IGL03134:G2e3 APN 12 51364030 intron probably benign
Amadeus UTSW 12 51353789 splice site probably null
R1868:G2e3 UTSW 12 51353629 missense probably benign 0.44
R2060:G2e3 UTSW 12 51372606 missense probably damaging 1.00
R3814:G2e3 UTSW 12 51353661 missense probably benign 0.28
R4355:G2e3 UTSW 12 51365337 missense probably benign 0.00
R4360:G2e3 UTSW 12 51363414 splice site probably benign
R4903:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4966:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4974:G2e3 UTSW 12 51369139 missense probably benign 0.00
R5399:G2e3 UTSW 12 51357194 critical splice donor site probably null
R5406:G2e3 UTSW 12 51372666 missense probably damaging 0.97
R5739:G2e3 UTSW 12 51372504 missense possibly damaging 0.94
R6225:G2e3 UTSW 12 51369136 missense possibly damaging 0.77
R6625:G2e3 UTSW 12 51353789 splice site probably null
R7458:G2e3 UTSW 12 51365507 missense possibly damaging 0.67
R7529:G2e3 UTSW 12 51371604 missense probably damaging 1.00
R7713:G2e3 UTSW 12 51369056 missense probably damaging 0.99
R7748:G2e3 UTSW 12 51371667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTCCCAATAAATACGGAGAAAAG -3'
(R):5'- CAGAAGTTCCCTCCTGATAAACTG -3'

Sequencing Primer
(F):5'- CCCAATAAATACGGAGAAAAGAAAAC -3'
(R):5'- CAGTGTAGGTTAAGCTCTTCTTTG -3'
Posted On2020-01-23