Incidental Mutation 'R7998:Tmprss15'
ID616224
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79001843 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 650 (L650F)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023566
AA Change: L650F

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: L650F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
AA Change: L635F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: L635F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 splice site probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 79071288 missense probably benign
R8537:Tmprss15 UTSW 16 79087515 missense probably damaging 0.99
R8735:Tmprss15 UTSW 16 79001814 missense possibly damaging 0.88
R8858:Tmprss15 UTSW 16 79057609 critical splice donor site probably null
R8869:Tmprss15 UTSW 16 78953946 nonsense probably null
R8884:Tmprss15 UTSW 16 79024769 missense probably benign 0.00
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCATCTCAGAATGCAGACAG -3'
(R):5'- AGCAAGACTTGGGGAACATTTC -3'

Sequencing Primer
(F):5'- TGCAGACAGATACATTGTGACTTGG -3'
(R):5'- CAAGACTTGGGGAACATTTCATCTGG -3'
Posted On2020-01-23