Incidental Mutation 'R7998:Arid1b'
ID616226
Institutional Source Beutler Lab
Gene Symbol Arid1b
Ensembl Gene ENSMUSG00000069729
Gene NameAT rich interactive domain 1B (SWI-like)
SynonymsB230217J03Rik, 9330189K18Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001085355.1; MGI:1926129

Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location4994332-5347656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5327684 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1236 (D1236G)
Ref Sequence ENSEMBL: ENSMUSP00000090398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092723] [ENSMUST00000115797] [ENSMUST00000115799] [ENSMUST00000232180]
Predicted Effect probably damaging
Transcript: ENSMUST00000092723
AA Change: D1236G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090398
Gene: ENSMUSG00000069729
AA Change: D1236G

DomainStartEndE-ValueType
low complexity region 2 51 N/A INTRINSIC
low complexity region 69 132 N/A INTRINSIC
low complexity region 139 150 N/A INTRINSIC
low complexity region 201 224 N/A INTRINSIC
low complexity region 232 247 N/A INTRINSIC
low complexity region 257 276 N/A INTRINSIC
low complexity region 301 371 N/A INTRINSIC
low complexity region 379 407 N/A INTRINSIC
low complexity region 438 476 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
low complexity region 538 558 N/A INTRINSIC
low complexity region 574 591 N/A INTRINSIC
low complexity region 596 611 N/A INTRINSIC
low complexity region 615 640 N/A INTRINSIC
low complexity region 691 707 N/A INTRINSIC
low complexity region 719 740 N/A INTRINSIC
low complexity region 743 773 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 912 930 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
low complexity region 1036 1045 N/A INTRINSIC
ARID 1057 1147 9.9e-33 SMART
BRIGHT 1061 1152 7.62e-41 SMART
low complexity region 1166 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1336 1364 N/A INTRINSIC
low complexity region 1426 1456 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
low complexity region 1579 1595 N/A INTRINSIC
coiled coil region 1724 1745 N/A INTRINSIC
low complexity region 1835 1843 N/A INTRINSIC
Pfam:DUF3518 1933 2189 1.5e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115797
AA Change: D1237G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111463
Gene: ENSMUSG00000069729
AA Change: D1237G

DomainStartEndE-ValueType
low complexity region 17 80 N/A INTRINSIC
low complexity region 87 98 N/A INTRINSIC
low complexity region 149 172 N/A INTRINSIC
low complexity region 180 195 N/A INTRINSIC
low complexity region 205 224 N/A INTRINSIC
low complexity region 249 319 N/A INTRINSIC
low complexity region 327 355 N/A INTRINSIC
low complexity region 386 424 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
low complexity region 486 506 N/A INTRINSIC
low complexity region 522 539 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
low complexity region 563 588 N/A INTRINSIC
low complexity region 639 655 N/A INTRINSIC
low complexity region 667 688 N/A INTRINSIC
low complexity region 691 721 N/A INTRINSIC
low complexity region 753 764 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 884 900 N/A INTRINSIC
low complexity region 922 933 N/A INTRINSIC
Blast:ARID 981 1028 1e-8 BLAST
low complexity region 1029 1054 N/A INTRINSIC
ARID 1058 1148 9.9e-33 SMART
BRIGHT 1062 1153 7.62e-41 SMART
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1258 1269 N/A INTRINSIC
low complexity region 1337 1365 N/A INTRINSIC
low complexity region 1427 1457 N/A INTRINSIC
low complexity region 1474 1487 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
coiled coil region 1725 1746 N/A INTRINSIC
low complexity region 1836 1844 N/A INTRINSIC
Pfam:DUF3518 1935 2190 6.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115799
AA Change: D755G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111465
Gene: ENSMUSG00000069729
AA Change: D755G

DomainStartEndE-ValueType
low complexity region 34 54 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
low complexity region 111 136 N/A INTRINSIC
low complexity region 187 203 N/A INTRINSIC
low complexity region 215 236 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 402 418 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
Blast:ARID 499 546 1e-8 BLAST
low complexity region 547 572 N/A INTRINSIC
ARID 576 666 9.9e-33 SMART
BRIGHT 580 671 7.62e-41 SMART
low complexity region 685 696 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 855 883 N/A INTRINSIC
low complexity region 945 975 N/A INTRINSIC
low complexity region 992 1005 N/A INTRINSIC
low complexity region 1098 1114 N/A INTRINSIC
coiled coil region 1243 1264 N/A INTRINSIC
low complexity region 1354 1362 N/A INTRINSIC
Pfam:DUF3518 1452 1708 1.1e-152 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000232180
AA Change: D1289G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an AT-rich DNA interacting domain-containing protein. The encoded protein is a component of the SWI/SNF chromatin remodeling complex and may play a role in cell-cycle activation. The protein encoded by this locus is similar to AT-rich interactive domain-containing protein 1A. These two proteins function as alternative, mutually exclusive ARID-subunits of the SWI/SNF complex. The associated complexes play opposing roles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI

All alleles(61) : Targeted(2) Gene trapped(59)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Arid1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Arid1b APN 17 5337110 missense possibly damaging 0.77
IGL00340:Arid1b APN 17 5321284 missense probably damaging 1.00
IGL00886:Arid1b APN 17 5126979 missense probably damaging 0.99
IGL01161:Arid1b APN 17 5342399 missense probably damaging 1.00
IGL01391:Arid1b APN 17 5318858 splice site probably benign
IGL01456:Arid1b APN 17 5291235 missense probably damaging 1.00
IGL02152:Arid1b APN 17 5313968 missense probably damaging 1.00
IGL02288:Arid1b APN 17 5264040 missense possibly damaging 0.88
IGL02713:Arid1b APN 17 5343011 missense probably damaging 1.00
IGL02858:Arid1b APN 17 5341891 missense possibly damaging 0.92
IGL02885:Arid1b APN 17 5342153 missense probably damaging 1.00
IGL02989:Arid1b APN 17 5335047 missense probably damaging 1.00
FR4449:Arid1b UTSW 17 4995589 small insertion probably benign
PIT4142001:Arid1b UTSW 17 5339243 missense probably damaging 1.00
R0048:Arid1b UTSW 17 5314034 critical splice donor site probably null
R0124:Arid1b UTSW 17 5339330 missense probably damaging 1.00
R0153:Arid1b UTSW 17 5342932 missense probably damaging 1.00
R0465:Arid1b UTSW 17 4996260 missense possibly damaging 0.68
R0825:Arid1b UTSW 17 5342178 missense probably damaging 1.00
R1172:Arid1b UTSW 17 5339300 missense probably damaging 1.00
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1468:Arid1b UTSW 17 5242922 missense probably damaging 0.99
R1616:Arid1b UTSW 17 5339294 missense probably damaging 1.00
R1754:Arid1b UTSW 17 5279201 critical splice acceptor site probably null
R1760:Arid1b UTSW 17 5341813 missense probably damaging 0.97
R1812:Arid1b UTSW 17 5337029 missense probably benign 0.10
R1911:Arid1b UTSW 17 5342966 missense probably damaging 1.00
R3874:Arid1b UTSW 17 5336515 splice site probably null
R3913:Arid1b UTSW 17 5342257 missense possibly damaging 0.94
R3916:Arid1b UTSW 17 5342653 missense probably benign 0.25
R3922:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R4119:Arid1b UTSW 17 4995794 unclassified probably benign
R4290:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4291:Arid1b UTSW 17 5040663 missense probably damaging 1.00
R4352:Arid1b UTSW 17 5097584 missense possibly damaging 0.93
R4386:Arid1b UTSW 17 4994972 unclassified probably benign
R4458:Arid1b UTSW 17 5242916 missense probably damaging 0.99
R4524:Arid1b UTSW 17 5097620 missense possibly damaging 0.93
R4622:Arid1b UTSW 17 4995050 unclassified probably benign
R4723:Arid1b UTSW 17 5337290 missense probably benign 0.01
R4782:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4799:Arid1b UTSW 17 5339221 missense probably damaging 1.00
R4910:Arid1b UTSW 17 5342203 missense probably damaging 1.00
R4946:Arid1b UTSW 17 5342843 missense probably damaging 0.99
R5083:Arid1b UTSW 17 5314018 missense possibly damaging 0.54
R5204:Arid1b UTSW 17 5343041 missense probably damaging 0.97
R5347:Arid1b UTSW 17 5291057 nonsense probably null
R5553:Arid1b UTSW 17 5313877 missense probably damaging 1.00
R5713:Arid1b UTSW 17 5336816 missense probably damaging 1.00
R5820:Arid1b UTSW 17 4996254 missense possibly damaging 0.96
R5992:Arid1b UTSW 17 4994956 unclassified probably benign
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6038:Arid1b UTSW 17 5336682 missense probably benign 0.07
R6153:Arid1b UTSW 17 5242832 missense probably damaging 1.00
R6222:Arid1b UTSW 17 5327647 critical splice acceptor site probably null
R6249:Arid1b UTSW 17 5279361 missense possibly damaging 0.61
R6279:Arid1b UTSW 17 5341999 missense probably damaging 1.00
R6329:Arid1b UTSW 17 5337263 nonsense probably null
R6368:Arid1b UTSW 17 5332533 missense possibly damaging 0.64
R6466:Arid1b UTSW 17 5327678 missense probably damaging 1.00
R6861:Arid1b UTSW 17 5327686 missense possibly damaging 0.93
R7008:Arid1b UTSW 17 5290979 missense probably damaging 1.00
R7270:Arid1b UTSW 17 4996043 missense unknown
R7514:Arid1b UTSW 17 5341714 missense probably benign 0.28
R7519:Arid1b UTSW 17 4995844 small insertion probably benign
R7519:Arid1b UTSW 17 4995853 small insertion probably benign
R7521:Arid1b UTSW 17 4995844 small insertion probably benign
R7521:Arid1b UTSW 17 4995860 small insertion probably benign
R7521:Arid1b UTSW 17 5342590 missense probably benign 0.06
R7616:Arid1b UTSW 17 4995386 missense unknown
R7654:Arid1b UTSW 17 5291085 missense possibly damaging 0.46
R7711:Arid1b UTSW 17 5336820 missense probably benign 0.28
R7828:Arid1b UTSW 17 5097668 missense probably damaging 1.00
R7864:Arid1b UTSW 17 5342255 missense probably damaging 1.00
R8105:Arid1b UTSW 17 5291243 missense possibly damaging 0.81
R8260:Arid1b UTSW 17 5332513 missense probably benign 0.03
R8374:Arid1b UTSW 17 5342644 missense possibly damaging 0.95
RF007:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995594 small insertion probably benign
RF008:Arid1b UTSW 17 4995595 small insertion probably benign
RF025:Arid1b UTSW 17 4995588 small insertion probably benign
RF025:Arid1b UTSW 17 4995596 small insertion probably benign
RF028:Arid1b UTSW 17 4995598 small insertion probably benign
RF032:Arid1b UTSW 17 4995588 small insertion probably benign
RF033:Arid1b UTSW 17 4995585 small insertion probably benign
RF041:Arid1b UTSW 17 4995595 small insertion probably benign
RF045:Arid1b UTSW 17 4995583 small insertion probably benign
RF046:Arid1b UTSW 17 4995590 small insertion probably benign
RF058:Arid1b UTSW 17 4995583 small insertion probably benign
X0023:Arid1b UTSW 17 5342393 missense probably benign 0.39
X0027:Arid1b UTSW 17 5342372 nonsense probably null
Z1177:Arid1b UTSW 17 4996328 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CTGCTCCTTTCAGCGTGTAG -3'
(R):5'- ACTACATGGCAGGGGCTTAG -3'

Sequencing Primer
(F):5'- GCTCCTTTCAGCGTGTAGTTTAC -3'
(R):5'- GGCTTAGAACCGTCCCAACTG -3'
Posted On2020-01-23