Incidental Mutation 'R7998:Pla2g7'
ID616228
Institutional Source Beutler Lab
Gene Symbol Pla2g7
Ensembl Gene ENSMUSG00000023913
Gene Namephospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)
SynonymsPAF acetylhydrolase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43568098-43612201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43611318 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 363 (I363L)
Ref Sequence ENSEMBL: ENSMUSP00000024706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024706] [ENSMUST00000045717] [ENSMUST00000168073] [ENSMUST00000169694]
Predicted Effect probably benign
Transcript: ENSMUST00000024706
AA Change: I363L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000024706
Gene: ENSMUSG00000023913
AA Change: I363L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 415 6e-179 PFAM
Pfam:Abhydrolase_5 145 351 3.2e-18 PFAM
Pfam:Abhydrolase_1 215 318 2.8e-7 PFAM
Pfam:Peptidase_S9 247 356 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045717
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168073
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169694
SMART Domains Protein: ENSMUSP00000132027
Gene: ENSMUSG00000023913

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PAF-AH_p_II 47 298 6.1e-120 PFAM
Pfam:Abhydrolase_5 145 298 1.4e-15 PFAM
Pfam:Abhydrolase_6 146 298 4.5e-11 PFAM
Pfam:Peptidase_S9 246 298 4.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted enzyme that catalyzes the degradation of platelet-activating factor to biologically inactive products. Defects in this gene are a cause of platelet-activating factor acetylhydrolase deficiency. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced early mortality in response to bacterial exposure, formula feeding and asphyxia, but survivors show a significantly higher incidence of necrotizing enterocolitis relative to wild-type controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nrxn2 T C 19: 6,509,875 V1221A probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Pla2g7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Pla2g7 APN 17 43602871 missense probably damaging 1.00
R0026:Pla2g7 UTSW 17 43594930 splice site probably benign
R0421:Pla2g7 UTSW 17 43611412 missense probably damaging 0.96
R1701:Pla2g7 UTSW 17 43600524 missense probably damaging 1.00
R4591:Pla2g7 UTSW 17 43600559 missense probably damaging 0.98
R5100:Pla2g7 UTSW 17 43611376 missense probably damaging 1.00
R5713:Pla2g7 UTSW 17 43594292 missense probably benign 0.03
R6404:Pla2g7 UTSW 17 43594797 missense probably damaging 1.00
R6433:Pla2g7 UTSW 17 43599126 missense probably damaging 1.00
R7180:Pla2g7 UTSW 17 43599076 missense probably damaging 1.00
R7903:Pla2g7 UTSW 17 43600621 splice site probably null
Z1176:Pla2g7 UTSW 17 43602919 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACAGTTCAGCAAACTAGTGGGG -3'
(R):5'- AGCCAAGTGGAAACAGCTAC -3'

Sequencing Primer
(F):5'- GTGCAATCTGGAAATCAATCCTTCC -3'
(R):5'- GGAAACAGCTACAATAAGACTATGTC -3'
Posted On2020-01-23