Incidental Mutation 'R7998:Nrxn2'
ID616231
Institutional Source Beutler Lab
Gene Symbol Nrxn2
Ensembl Gene ENSMUSG00000033768
Gene Nameneurexin II
Synonyms6430591O13Rik, neurexin II beta, neurexin II alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7998 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6418731-6544169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6509875 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1221 (V1221A)
Ref Sequence ENSEMBL: ENSMUSP00000109089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077182] [ENSMUST00000113458] [ENSMUST00000113459] [ENSMUST00000113461] [ENSMUST00000113462] [ENSMUST00000137166]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077182
AA Change: V1213A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076424
Gene: ENSMUSG00000033768
AA Change: V1213A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 444 1.18e-33 SMART
LamG 498 651 1.51e-40 SMART
EGF 678 712 8.91e-3 SMART
LamG 737 875 4.91e-22 SMART
LamG 923 1059 1.08e-41 SMART
EGF 1084 1118 1.91e1 SMART
LamG 1146 1303 4.48e-16 SMART
low complexity region 1332 1362 N/A INTRINSIC
low complexity region 1430 1445 N/A INTRINSIC
4.1m 1448 1466 3.75e-4 SMART
low complexity region 1480 1499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113458
AA Change: V178A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109085
Gene: ENSMUSG00000033768
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 268 4.48e-16 SMART
low complexity region 297 327 N/A INTRINSIC
low complexity region 383 404 N/A INTRINSIC
low complexity region 587 602 N/A INTRINSIC
4.1m 605 623 3.75e-4 SMART
low complexity region 637 656 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113459
AA Change: V178A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109086
Gene: ENSMUSG00000033768
AA Change: V178A

DomainStartEndE-ValueType
signal peptide 1 46 N/A INTRINSIC
low complexity region 49 69 N/A INTRINSIC
LamG 111 238 1.26e-19 SMART
low complexity region 267 297 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113461
AA Change: V1188A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109088
Gene: ENSMUSG00000033768
AA Change: V1188A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
LamG 286 428 8.4e-30 SMART
LamG 482 635 1.51e-40 SMART
EGF 662 696 8.91e-3 SMART
LamG 721 850 2.36e-24 SMART
LamG 898 1034 1.08e-41 SMART
EGF 1059 1093 1.91e1 SMART
LamG 1121 1248 1.26e-19 SMART
low complexity region 1277 1307 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
low complexity region 1567 1582 N/A INTRINSIC
4.1m 1585 1603 3.75e-4 SMART
low complexity region 1617 1636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113462
AA Change: V1221A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109089
Gene: ENSMUSG00000033768
AA Change: V1221A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 452 8.4e-30 SMART
LamG 506 659 1.51e-40 SMART
EGF 686 720 8.91e-3 SMART
LamG 745 883 4.91e-22 SMART
LamG 931 1067 1.08e-41 SMART
EGF 1092 1126 1.91e1 SMART
LamG 1154 1311 4.48e-16 SMART
low complexity region 1340 1370 N/A INTRINSIC
low complexity region 1426 1447 N/A INTRINSIC
low complexity region 1630 1645 N/A INTRINSIC
4.1m 1648 1666 3.75e-4 SMART
low complexity region 1680 1699 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137166
AA Change: V1228A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119762
Gene: ENSMUSG00000033768
AA Change: V1228A

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
LamG 49 187 1.67e-33 SMART
EGF 205 242 1.73e1 SMART
low complexity region 268 276 N/A INTRINSIC
LamG 310 459 8.87e-29 SMART
LamG 513 666 1.51e-40 SMART
EGF 693 727 8.91e-3 SMART
LamG 752 890 4.91e-22 SMART
LamG 938 1074 1.08e-41 SMART
EGF 1099 1133 1.91e1 SMART
LamG 1161 1318 4.48e-16 SMART
low complexity region 1347 1377 N/A INTRINSIC
low complexity region 1433 1454 N/A INTRINSIC
low complexity region 1637 1652 N/A INTRINSIC
4.1m 1655 1673 3.75e-4 SMART
low complexity region 1687 1706 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin gene family. The products of these genes function as cell adhesion molecules and receptors in the vertebrate nervous system. These genes utilize two promoters. The majority of transcripts are produced from the upstream promoter and encode alpha-neurexin isoforms while a smaller number of transcripts are produced from the downstream promoter and encode beta-neuresin isoforms. The alpha-neurexins contain epidermal growth factor-like (EGF-like) sequences and laminin G domains, and have been shown to interact with neurexophilins. The beta-neurexins lack EGF-like sequences and contain fewer laminin G domains than alpha-neurexins. Alternative splicing and the use of alternative promoters may generate thousands of transcript variants (PMID: 12036300, PMID: 11944992).[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are generally non-viable; surviving homozygotes show a 30-40% decrease in body weight and their inhibitory postsynaptic currents (IPSCs) are decreased in cortical slice cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,096,692 R216C probably benign Het
Acsl3 C T 1: 78,694,271 P294L probably damaging Het
Alox12b T C 11: 69,168,837 Y572H probably damaging Het
Arid1b A G 17: 5,327,684 D1236G probably damaging Het
Astl T C 2: 127,350,499 L254P probably damaging Het
Btbd7 A C 12: 102,795,240 L562R probably damaging Het
Ccdc58 T A 16: 36,085,033 V65D probably benign Het
Chl1 T C 6: 103,729,289 V1195A probably benign Het
Cib1 A T 7: 80,228,414 Y105* probably null Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Cpne6 A C 14: 55,516,294 Q403P probably damaging Het
Csn1s1 A G 5: 87,674,228 N119S possibly damaging Het
Cux2 T C 5: 121,868,585 D874G possibly damaging Het
Dicer1 A T 12: 104,704,069 F1079Y probably damaging Het
Dsc2 T A 18: 20,034,663 Q724H possibly damaging Het
Fam96b T A 8: 104,641,036 S94C probably damaging Het
Fbxw16 A G 9: 109,436,698 V351A probably damaging Het
G2e3 A T 12: 51,353,841 E59D probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm10837 G T 14: 122,490,641 probably benign Het
Gm14085 T C 2: 122,494,358 L137P probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gpr18 T C 14: 121,911,981 I211V probably benign Het
Gstm7 T A 3: 107,930,341 D98V probably damaging Het
Hspa8 A G 9: 40,804,514 Y525C probably damaging Het
Itga7 T C 10: 128,934,151 S55P probably damaging Het
Itpr1 T C 6: 108,417,948 V1674A possibly damaging Het
Itsn1 G T 16: 91,850,936 G893C unknown Het
Kcnc1 A G 7: 46,397,799 D41G probably benign Het
Larp6 A G 9: 60,724,355 K137E probably damaging Het
Leo1 G T 9: 75,445,276 G34C probably benign Het
Map4 G A 9: 110,079,861 V1050M probably damaging Het
Mast3 A G 8: 70,783,570 V722A probably benign Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mier1 T C 4: 103,162,615 F512S probably benign Het
Mov10l1 T A 15: 89,053,439 V1147E probably damaging Het
Mroh7 T C 4: 106,711,281 E409G probably benign Het
Muc16 G T 9: 18,639,892 P5035Q probably benign Het
Nemp1 C A 10: 127,693,489 S213R probably damaging Het
Npffr2 T C 5: 89,583,290 Y360H probably damaging Het
Nup107 A G 10: 117,757,994 F765L probably damaging Het
Nup188 T C 2: 30,330,971 L991P probably damaging Het
Olfr205 T A 16: 59,329,270 M80L probably benign Het
Olfr275 A T 4: 52,825,970 D191V possibly damaging Het
Pla2g7 A T 17: 43,611,318 I363L probably benign Het
Ppp2r1a T C 17: 20,961,639 F473S possibly damaging Het
Prex1 A G 2: 166,587,045 probably null Het
Ptov1 A G 7: 44,864,929 V263A probably damaging Het
Reg3a T C 6: 78,381,149 V21A probably benign Het
Sdk2 T A 11: 113,859,938 I550F probably benign Het
Shprh T A 10: 11,185,341 W1133R probably damaging Het
Syne2 T C 12: 76,087,858 V1297A probably damaging Het
Themis2 A G 4: 132,792,564 I50T probably damaging Het
Tmprss15 C A 16: 79,001,843 L650F possibly damaging Het
Ttc41 C A 10: 86,736,847 N694K probably benign Het
Ttll9 T C 2: 152,991,626 Y215H possibly damaging Het
Ttn C A 2: 76,903,309 V4541L unknown Het
Usp32 G T 11: 84,994,426 A1265E probably damaging Het
Vcan T A 13: 89,704,327 D838V probably damaging Het
Vmn2r88 T C 14: 51,414,108 I293T Het
Wdr36 T G 18: 32,852,519 D496E probably damaging Het
Wrn T C 8: 33,292,643 N753S probably benign Het
Zmat3 T C 3: 32,341,666 R231G possibly damaging Het
Other mutations in Nrxn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nrxn2 APN 19 6473593 missense possibly damaging 0.84
IGL01020:Nrxn2 APN 19 6493443 missense probably benign 0.02
IGL01064:Nrxn2 APN 19 6517053 missense probably damaging 0.97
IGL01561:Nrxn2 APN 19 6490142 missense probably damaging 1.00
IGL01759:Nrxn2 APN 19 6509929 missense probably damaging 1.00
IGL02071:Nrxn2 APN 19 6481753 missense probably damaging 1.00
IGL02085:Nrxn2 APN 19 6492868 missense possibly damaging 0.83
IGL02132:Nrxn2 APN 19 6472276 missense probably damaging 1.00
IGL02476:Nrxn2 APN 19 6454985 missense probably damaging 1.00
IGL02605:Nrxn2 APN 19 6450580 missense probably benign 0.02
IGL03123:Nrxn2 APN 19 6481737 missense probably damaging 0.98
IGL03288:Nrxn2 APN 19 6490696 missense probably damaging 1.00
PIT4687001:Nrxn2 UTSW 19 6481308 missense probably benign 0.06
R0019:Nrxn2 UTSW 19 6509957 splice site probably benign
R0257:Nrxn2 UTSW 19 6490698 missense possibly damaging 0.81
R0305:Nrxn2 UTSW 19 6519283 missense probably damaging 1.00
R0453:Nrxn2 UTSW 19 6491521 missense probably damaging 1.00
R0512:Nrxn2 UTSW 19 6517198 missense probably damaging 1.00
R0539:Nrxn2 UTSW 19 6493404 missense probably damaging 0.99
R0571:Nrxn2 UTSW 19 6473533 missense probably damaging 1.00
R1373:Nrxn2 UTSW 19 6472301 missense probably damaging 1.00
R1434:Nrxn2 UTSW 19 6443612 splice site probably null
R1454:Nrxn2 UTSW 19 6481446 missense probably damaging 0.98
R1671:Nrxn2 UTSW 19 6473750 missense probably damaging 1.00
R1692:Nrxn2 UTSW 19 6519268 missense probably damaging 1.00
R1858:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R1859:Nrxn2 UTSW 19 6488795 missense probably benign 0.01
R2153:Nrxn2 UTSW 19 6504914 missense probably damaging 1.00
R2196:Nrxn2 UTSW 19 6490109 missense probably damaging 1.00
R2209:Nrxn2 UTSW 19 6493007 missense probably benign 0.01
R2278:Nrxn2 UTSW 19 6481853 missense probably damaging 1.00
R2441:Nrxn2 UTSW 19 6428301 missense probably damaging 1.00
R3897:Nrxn2 UTSW 19 6519257 missense probably damaging 1.00
R3943:Nrxn2 UTSW 19 6473335 missense probably damaging 1.00
R4091:Nrxn2 UTSW 19 6473414 missense probably damaging 1.00
R4162:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4164:Nrxn2 UTSW 19 6532143 missense probably damaging 1.00
R4495:Nrxn2 UTSW 19 6531399 missense probably benign 0.05
R4599:Nrxn2 UTSW 19 6455252 missense probably damaging 0.98
R4735:Nrxn2 UTSW 19 6498454 missense possibly damaging 0.86
R4757:Nrxn2 UTSW 19 6509821 missense probably damaging 1.00
R4890:Nrxn2 UTSW 19 6448278 missense possibly damaging 0.90
R5052:Nrxn2 UTSW 19 6455204 missense probably damaging 1.00
R5311:Nrxn2 UTSW 19 6531398 missense probably benign 0.05
R5330:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5331:Nrxn2 UTSW 19 6490081 missense probably damaging 0.96
R5530:Nrxn2 UTSW 19 6498367 missense possibly damaging 0.93
R5556:Nrxn2 UTSW 19 6490091 missense probably damaging 1.00
R5763:Nrxn2 UTSW 19 6531339 missense probably benign 0.15
R5829:Nrxn2 UTSW 19 6490849 missense probably benign 0.03
R5988:Nrxn2 UTSW 19 6492871 missense possibly damaging 0.83
R6003:Nrxn2 UTSW 19 6498328 missense possibly damaging 0.93
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6032:Nrxn2 UTSW 19 6517132 missense probably damaging 1.00
R6288:Nrxn2 UTSW 19 6490561 missense probably damaging 1.00
R6334:Nrxn2 UTSW 19 6531292 splice site probably null
R6373:Nrxn2 UTSW 19 6509830 missense probably damaging 1.00
R6397:Nrxn2 UTSW 19 6532122 missense probably damaging 1.00
R6669:Nrxn2 UTSW 19 6481191 missense probably damaging 1.00
R6980:Nrxn2 UTSW 19 6450579 missense probably benign 0.04
R6985:Nrxn2 UTSW 19 6481245 missense probably damaging 1.00
R7184:Nrxn2 UTSW 19 6490552 missense probably damaging 1.00
R7361:Nrxn2 UTSW 19 6517082 missense probably benign 0.00
R7576:Nrxn2 UTSW 19 6531510 nonsense probably null
R7604:Nrxn2 UTSW 19 6531961 missense probably damaging 1.00
R7631:Nrxn2 UTSW 19 6481795 missense possibly damaging 0.83
R7768:Nrxn2 UTSW 19 6481379 missense possibly damaging 0.69
R7805:Nrxn2 UTSW 19 6531706 missense probably benign
R7896:Nrxn2 UTSW 19 6532053 missense possibly damaging 0.89
R8383:Nrxn2 UTSW 19 6472313 missense probably damaging 1.00
R8505:Nrxn2 UTSW 19 6490133 missense probably damaging 1.00
X0022:Nrxn2 UTSW 19 6509917 missense probably damaging 1.00
Z1177:Nrxn2 UTSW 19 6498517 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTGAGCCCTGAAGAGGTG -3'
(R):5'- AGTCTTTTCCATAGCCACGC -3'

Sequencing Primer
(F):5'- GCCCTGAAGAGGTGTCTTATAAATTC -3'
(R):5'- GCCCGAAGCCTCTCCACTTAG -3'
Posted On2020-01-23