Incidental Mutation 'R7999:Ren1'
ID616232
Institutional Source Beutler Lab
Gene Symbol Ren1
Ensembl Gene ENSMUSG00000070645
Gene Namerenin 1 structural
SynonymsRen-1, Ren1d, Ren1c, Ren, Ren-A, Rnr, Rn-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7999 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location133350510-133360325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 133354866 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 103 (T103K)
Ref Sequence ENSEMBL: ENSMUSP00000092135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094556] [ENSMUST00000112287]
Predicted Effect probably damaging
Transcript: ENSMUST00000094556
AA Change: T103K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092135
Gene: ENSMUSG00000070645
AA Change: T103K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A1_Propeptide 29 54 1.2e-10 PFAM
Pfam:Asp 83 401 1.3e-120 PFAM
Pfam:TAXi_C 261 400 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112287
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Renin catalyzes the first step in the activation pathway of angiotensinogen--a cascade that can result in aldosterone release,vasoconstriction, and increase in blood pressure. Renin, an aspartyl protease, cleaves angiotensinogen to form angiotensin I, which is converted to angiotensin II by angiotensin I converting enzyme, an important regulator of blood pressure and electrolyte balance. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause familial hyperproreninemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to postnatal lethality, reduced plasma renin level, decreased mean arterial pressure, and kidney defects such as atrophy, altered juxtaglomerular cell and macula densa morphology, polyuria, decreased urine osmolality, and reduced glomerular filtration rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,737,452 V753L probably benign Het
Ahi1 A G 10: 20,965,681 E289G probably benign Het
AI481877 G C 4: 59,094,162 F187L probably benign Het
Armc2 C T 10: 42,011,958 E10K possibly damaging Het
Aspscr1 T C 11: 120,678,522 probably null Het
B3galnt1 A G 3: 69,575,215 C238R probably damaging Het
Bak1 A G 17: 27,021,306 L129P probably damaging Het
Bdp1 A G 13: 100,058,896 F1272L possibly damaging Het
C2cd3 G A 7: 100,459,889 probably null Het
Cacna1b A T 2: 24,650,626 V1363E probably damaging Het
Capn11 T C 17: 45,639,206 N344S probably damaging Het
Ces1f A T 8: 93,262,995 V431E possibly damaging Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Defa29 A T 8: 21,326,843 S45T probably benign Het
Dnah10 A G 5: 124,725,258 D32G probably benign Het
Dnajc24 T A 2: 105,981,020 N70I probably damaging Het
Duox2 C T 2: 122,283,467 V1195I probably benign Het
E430018J23Rik T A 7: 127,392,428 S117C probably damaging Het
Enam A T 5: 88,503,702 R1023S probably benign Het
Ephx4 A T 5: 107,419,833 Q219L probably damaging Het
Eppk1 T C 15: 76,109,004 T1226A probably benign Het
Eppk1 T C 15: 76,109,135 Q1182R probably benign Het
Fiz1 A T 7: 5,008,998 S174T probably benign Het
Ggnbp1 C T 17: 27,029,645 R63C probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsdmd T A 15: 75,863,446 I13N probably damaging Het
Gtpbp4 T C 13: 8,987,286 D292G probably damaging Het
Hnf1a A T 5: 114,960,174 L123* probably null Het
Ints11 A G 4: 155,886,956 D309G probably benign Het
Ints5 T C 19: 8,897,043 S789P probably benign Het
Jakmip2 G A 18: 43,563,333 A517V probably benign Het
Kat7 A G 11: 95,284,109 Y270H probably damaging Het
Kmt2b A G 7: 30,576,774 S1767P probably damaging Het
Lonp2 A G 8: 86,634,909 D238G probably benign Het
Lrfn3 A G 7: 30,360,024 W259R probably damaging Het
Mmrn2 G A 14: 34,397,922 D250N probably benign Het
Mre11a A T 9: 14,799,669 R49* probably null Het
Mug1 T C 6: 121,880,896 L1116P possibly damaging Het
Mup9 A G 4: 60,418,203 S234P probably benign Het
Nlrp9c A G 7: 26,385,489 F222L possibly damaging Het
Nr2e3 A G 9: 59,948,999 V85A probably damaging Het
Olfr1252 A G 2: 89,722,000 I37T probably benign Het
Prl3d2 A G 13: 27,123,966 T77A probably benign Het
Prpsap1 A T 11: 116,490,216 M1K probably null Het
Prrc2b C T 2: 32,194,414 T297M probably damaging Het
Rasa3 A G 8: 13,631,805 F48S probably benign Het
Rbm24 A T 13: 46,419,031 M1L possibly damaging Het
Rpf2 C T 10: 40,223,884 G260S probably damaging Het
Sall4 C T 2: 168,752,641 G862D probably damaging Het
Samd4 G T 14: 47,064,247 R336L probably damaging Het
Siglec1 T C 2: 131,071,163 N1611S probably benign Het
Skil A G 3: 31,097,602 H91R possibly damaging Het
Snip1 T C 4: 125,071,381 V193A probably benign Het
Sp2 A T 11: 96,961,837 I87N probably damaging Het
Syna T C 5: 134,559,192 H301R probably benign Het
Tdg A G 10: 82,641,382 K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 probably null Het
Trak1 G A 9: 121,460,425 R601H probably damaging Het
Triobp T C 15: 78,959,944 L120P probably damaging Het
Utp20 A T 10: 88,770,388 N1697K probably benign Het
Uts2r G A 11: 121,160,669 V120M possibly damaging Het
Vmn2r59 A G 7: 42,046,832 L162P probably damaging Het
Zbtb17 G A 4: 141,461,823 R18Q probably damaging Het
Zfp551 A T 7: 12,417,211 C90* probably null Het
Zfp605 T A 5: 110,128,434 C473S probably damaging Het
Zfp975 A T 7: 42,662,932 Y86N probably benign Het
Other mutations in Ren1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ren1 APN 1 133358412 missense probably benign 0.00
IGL02172:Ren1 APN 1 133359033 missense possibly damaging 0.95
IGL02686:Ren1 APN 1 133358469 missense possibly damaging 0.86
3_musketeers UTSW 1 133354808 missense probably damaging 1.00
snickers UTSW 1 133356518 missense probably damaging 1.00
R0268:Ren1 UTSW 1 133355611 missense possibly damaging 0.74
R1115:Ren1 UTSW 1 133356518 missense probably damaging 1.00
R1728:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1728:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1728:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1728:Ren1 UTSW 1 133358982 unclassified probably null
R1728:Ren1 UTSW 1 133359079 missense probably benign
R1728:Ren1 UTSW 1 133359983 missense probably benign
R1728:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1729:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1729:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1729:Ren1 UTSW 1 133359079 missense probably benign
R1729:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1730:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1730:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1730:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1730:Ren1 UTSW 1 133359079 missense probably benign
R1730:Ren1 UTSW 1 133359983 missense probably benign
R1730:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1739:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1739:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1739:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1739:Ren1 UTSW 1 133359079 missense probably benign
R1739:Ren1 UTSW 1 133359983 missense probably benign
R1739:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1762:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1762:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1762:Ren1 UTSW 1 133358982 unclassified probably null
R1762:Ren1 UTSW 1 133359079 missense probably benign
R1762:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1783:Ren1 UTSW 1 133350778 unclassified probably null
R1783:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1783:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1783:Ren1 UTSW 1 133359079 missense probably benign
R1783:Ren1 UTSW 1 133359983 missense probably benign
R1783:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1784:Ren1 UTSW 1 133350778 unclassified probably null
R1784:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1784:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1784:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1784:Ren1 UTSW 1 133359079 missense probably benign
R1784:Ren1 UTSW 1 133359983 missense probably benign
R1784:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1785:Ren1 UTSW 1 133350778 unclassified probably null
R1785:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1785:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1785:Ren1 UTSW 1 133359079 missense probably benign
R1785:Ren1 UTSW 1 133359983 missense probably benign
R1785:Ren1 UTSW 1 133360007 missense probably benign 0.02
R2049:Ren1 UTSW 1 133350778 unclassified probably null
R2130:Ren1 UTSW 1 133350778 unclassified probably null
R2131:Ren1 UTSW 1 133350778 unclassified probably null
R2133:Ren1 UTSW 1 133358982 unclassified probably null
R2141:Ren1 UTSW 1 133350778 unclassified probably null
R2142:Ren1 UTSW 1 133350778 unclassified probably null
R2518:Ren1 UTSW 1 133360124 missense probably damaging 1.00
R4361:Ren1 UTSW 1 133359041 missense probably benign
R4584:Ren1 UTSW 1 133354808 missense probably damaging 1.00
R5188:Ren1 UTSW 1 133350613 unclassified probably benign
R5806:Ren1 UTSW 1 133355511 nonsense probably null
R8093:Ren1 UTSW 1 133360074 missense probably damaging 1.00
R8175:Ren1 UTSW 1 133354269 missense possibly damaging 0.94
R8259:Ren1 UTSW 1 133350796 nonsense probably null
RF037:Ren1 UTSW 1 133350781 unclassified probably benign
RF044:Ren1 UTSW 1 133350781 unclassified probably benign
Z1177:Ren1 UTSW 1 133350750 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGACAATGCTGAGTCCTCAC -3'
(R):5'- ACCTTGGTTGCCATTTCAGAAAG -3'

Sequencing Primer
(F):5'- GACAATGCTGAGTCCTCACATCTC -3'
(R):5'- CTTGGTTGCCATTTCAGAAAGAAGAG -3'
Posted On2020-01-23