Incidental Mutation 'R7999:C2cd3'
ID616264
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene NameC2 calcium-dependent domain containing 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7999 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location100372233-100470152 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 100459889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
Predicted Effect probably null
Transcript: ENSMUST00000051777
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098259
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120196
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,737,452 V753L probably benign Het
Ahi1 A G 10: 20,965,681 E289G probably benign Het
AI481877 G C 4: 59,094,162 F187L probably benign Het
Armc2 C T 10: 42,011,958 E10K possibly damaging Het
Aspscr1 T C 11: 120,678,522 probably null Het
B3galnt1 A G 3: 69,575,215 C238R probably damaging Het
Bak1 A G 17: 27,021,306 L129P probably damaging Het
Bdp1 A G 13: 100,058,896 F1272L possibly damaging Het
Cacna1b A T 2: 24,650,626 V1363E probably damaging Het
Capn11 T C 17: 45,639,206 N344S probably damaging Het
Ces1f A T 8: 93,262,995 V431E possibly damaging Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Defa29 A T 8: 21,326,843 S45T probably benign Het
Dnah10 A G 5: 124,725,258 D32G probably benign Het
Dnajc24 T A 2: 105,981,020 N70I probably damaging Het
Duox2 C T 2: 122,283,467 V1195I probably benign Het
E430018J23Rik T A 7: 127,392,428 S117C probably damaging Het
Enam A T 5: 88,503,702 R1023S probably benign Het
Ephx4 A T 5: 107,419,833 Q219L probably damaging Het
Eppk1 T C 15: 76,109,004 T1226A probably benign Het
Eppk1 T C 15: 76,109,135 Q1182R probably benign Het
Fiz1 A T 7: 5,008,998 S174T probably benign Het
Ggnbp1 C T 17: 27,029,645 R63C probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsdmd T A 15: 75,863,446 I13N probably damaging Het
Gtpbp4 T C 13: 8,987,286 D292G probably damaging Het
Hnf1a A T 5: 114,960,174 L123* probably null Het
Ints11 A G 4: 155,886,956 D309G probably benign Het
Ints5 T C 19: 8,897,043 S789P probably benign Het
Jakmip2 G A 18: 43,563,333 A517V probably benign Het
Kat7 A G 11: 95,284,109 Y270H probably damaging Het
Kmt2b A G 7: 30,576,774 S1767P probably damaging Het
Lonp2 A G 8: 86,634,909 D238G probably benign Het
Lrfn3 A G 7: 30,360,024 W259R probably damaging Het
Mmrn2 G A 14: 34,397,922 D250N probably benign Het
Mre11a A T 9: 14,799,669 R49* probably null Het
Mug1 T C 6: 121,880,896 L1116P possibly damaging Het
Mup9 A G 4: 60,418,203 S234P probably benign Het
Nlrp9c A G 7: 26,385,489 F222L possibly damaging Het
Nr2e3 A G 9: 59,948,999 V85A probably damaging Het
Olfr1252 A G 2: 89,722,000 I37T probably benign Het
Prl3d2 A G 13: 27,123,966 T77A probably benign Het
Prpsap1 A T 11: 116,490,216 M1K probably null Het
Prrc2b C T 2: 32,194,414 T297M probably damaging Het
Rasa3 A G 8: 13,631,805 F48S probably benign Het
Rbm24 A T 13: 46,419,031 M1L possibly damaging Het
Ren1 C A 1: 133,354,866 T103K probably damaging Het
Rpf2 C T 10: 40,223,884 G260S probably damaging Het
Sall4 C T 2: 168,752,641 G862D probably damaging Het
Samd4 G T 14: 47,064,247 R336L probably damaging Het
Siglec1 T C 2: 131,071,163 N1611S probably benign Het
Skil A G 3: 31,097,602 H91R possibly damaging Het
Snip1 T C 4: 125,071,381 V193A probably benign Het
Sp2 A T 11: 96,961,837 I87N probably damaging Het
Syna T C 5: 134,559,192 H301R probably benign Het
Tdg A G 10: 82,641,382 K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 probably null Het
Trak1 G A 9: 121,460,425 R601H probably damaging Het
Triobp T C 15: 78,959,944 L120P probably damaging Het
Utp20 A T 10: 88,770,388 N1697K probably benign Het
Uts2r G A 11: 121,160,669 V120M possibly damaging Het
Vmn2r59 A G 7: 42,046,832 L162P probably damaging Het
Zbtb17 G A 4: 141,461,823 R18Q probably damaging Het
Zfp551 A T 7: 12,417,211 C90* probably null Het
Zfp605 T A 5: 110,128,434 C473S probably damaging Het
Zfp975 A T 7: 42,662,932 Y86N probably benign Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100391128 missense probably benign 0.14
IGL01420:C2cd3 APN 7 100454858 missense probably benign 0.35
IGL01775:C2cd3 APN 7 100443431 missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100427214 missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100374486 missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100419715 missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100427169 unclassified probably benign
IGL02852:C2cd3 APN 7 100430189 missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100374476 missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100418522 missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100416062 missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0032:C2cd3 UTSW 7 100444445 unclassified probably benign
R0124:C2cd3 UTSW 7 100469518 missense probably benign
R0387:C2cd3 UTSW 7 100422507 splice site probably benign
R0522:C2cd3 UTSW 7 100395222 missense probably benign 0.14
R1124:C2cd3 UTSW 7 100422681 missense probably benign 0.00
R1484:C2cd3 UTSW 7 100440190 missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100406077 missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100372497 critical splice donor site probably null
R1875:C2cd3 UTSW 7 100407025 missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100455493 unclassified probably benign
R2060:C2cd3 UTSW 7 100454948 missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100413366 missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100395252 missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R3687:C2cd3 UTSW 7 100435833 missense probably benign 0.28
R3775:C2cd3 UTSW 7 100431998 missense probably damaging 1.00
R3854:C2cd3 UTSW 7 100454601 critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100441089 missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100432099 missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100374477 missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100372450 unclassified probably benign
R4705:C2cd3 UTSW 7 100395188 missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100443435 missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100416332 missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100391019 missense probably benign 0.01
R4842:C2cd3 UTSW 7 100416190 missense probably benign 0.00
R4858:C2cd3 UTSW 7 100454953 missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100413374 missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100405959 missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100459842 missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100443485 missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100390166 missense probably benign 0.01
R5538:C2cd3 UTSW 7 100455493 critical splice donor site probably null
R5861:C2cd3 UTSW 7 100444475 unclassified probably benign
R6110:C2cd3 UTSW 7 100441076 missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100416428 missense probably benign 0.02
R6429:C2cd3 UTSW 7 100432091 missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100455298 missense probably benign
R6613:C2cd3 UTSW 7 100395241 missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100418540 missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100455346 missense probably benign
R6837:C2cd3 UTSW 7 100448746 missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100406927 missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100390241 missense probably benign 0.28
R6929:C2cd3 UTSW 7 100451619 missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100432092 missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100416181 missense
R7174:C2cd3 UTSW 7 100432198 missense
R7241:C2cd3 UTSW 7 100407050 missense
R7335:C2cd3 UTSW 7 100422603 missense
R7357:C2cd3 UTSW 7 100430103 missense
R7493:C2cd3 UTSW 7 100427226 missense
R7567:C2cd3 UTSW 7 100430815 missense
R7573:C2cd3 UTSW 7 100419707 missense
R7869:C2cd3 UTSW 7 100469491 missense probably damaging 0.99
R8134:C2cd3 UTSW 7 100418504 missense
R8369:C2cd3 UTSW 7 100395258 missense probably benign 0.03
R8372:C2cd3 UTSW 7 100455280 nonsense probably null
X0002:C2cd3 UTSW 7 100440235 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGATGGTATGACTGTGGTCCC -3'
(R):5'- TGCCAGTCTTAGCTGACAAG -3'

Sequencing Primer
(F):5'- ATGACTGTGGTCCCTGGGG -3'
(R):5'- CAGTCTTAGCTGACAAGGCTCTG -3'
Posted On2020-01-23