Mutagenetix > Incidental Mutation

Incidental Mutation 'R7999:Mre11a'

616270

Institutional Source

Beutler Lab

Gene Symbol

Mre11a

Ensembl Gene

ENSMUSG00000031928

Gene Name

MRE11A homolog A, double strand break repair nuclease

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7999 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14784654-14837123 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 14799669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 49 (R49*)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]

AlphaFold

Q61216

Predicted Effect

probably damaging
Transcript: ENSMUST00000034405
AA Change: R220W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: R220W

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	6.3e-15	PFAM
Mre11_DNA_bind	294	462	1.72e-70	SMART
coiled coil region	487	519	N/A	INTRINSIC
low complexity region	566	594	N/A	INTRINSIC
low complexity region	683	699	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115632
AA Change: R220W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: R220W

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	249	1.1e-31	PFAM
Mre11_DNA_bind	294	435	7.6e-49	SMART
coiled coil region	460	492	N/A	INTRINSIC
low complexity region	539	567	N/A	INTRINSIC
low complexity region	656	672	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147305

SMART Domains

Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928

Domain	Start	End	E-Value	Type
Pfam:Metallophos	13	199	1.2e-22	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000147676
AA Change: R49*

SMART Domains

Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: R49*

Domain	Start	End	E-Value	Type
PDB:3T1I\|D	2	50	3e-26	PDB
Mre11_DNA_bind	62	170	1.81e-32	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,737,452	V753L	probably benign	Het
Ahi1	A	G	10: 20,965,681	E289G	probably benign	Het
AI481877	G	C	4: 59,094,162	F187L	probably benign	Het
Armc2	C	T	10: 42,011,958	E10K	possibly damaging	Het
Aspscr1	T	C	11: 120,678,522		probably null	Het
B3galnt1	A	G	3: 69,575,215	C238R	probably damaging	Het
Bak1	A	G	17: 27,021,306	L129P	probably damaging	Het
Bdp1	A	G	13: 100,058,896	F1272L	possibly damaging	Het
C2cd3	G	A	7: 100,459,889		probably null	Het
Cacna1b	A	T	2: 24,650,626	V1363E	probably damaging	Het
Capn11	T	C	17: 45,639,206	N344S	probably damaging	Het
Ces1f	A	T	8: 93,262,995	V431E	possibly damaging	Het
Cog3	G	T	14: 75,747,093	S94Y	possibly damaging	Het
Defa29	A	T	8: 21,326,843	S45T	probably benign	Het
Dnah10	A	G	5: 124,725,258	D32G	probably benign	Het
Dnajc24	T	A	2: 105,981,020	N70I	probably damaging	Het
Duox2	C	T	2: 122,283,467	V1195I	probably benign	Het
E430018J23Rik	T	A	7: 127,392,428	S117C	probably damaging	Het
Enam	A	T	5: 88,503,702	R1023S	probably benign	Het
Ephx4	A	T	5: 107,419,833	Q219L	probably damaging	Het
Eppk1	T	C	15: 76,109,004	T1226A	probably benign	Het
Eppk1	T	C	15: 76,109,135	Q1182R	probably benign	Het
Fiz1	A	T	7: 5,008,998	S174T	probably benign	Het
Ggnbp1	C	T	17: 27,029,645	R63C	probably benign	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gsdmd	T	A	15: 75,863,446	I13N	probably damaging	Het
Gtpbp4	T	C	13: 8,987,286	D292G	probably damaging	Het
Hnf1a	A	T	5: 114,960,174	L123*	probably null	Het
Ints11	A	G	4: 155,886,956	D309G	probably benign	Het
Ints5	T	C	19: 8,897,043	S789P	probably benign	Het
Jakmip2	G	A	18: 43,563,333	A517V	probably benign	Het
Kat7	A	G	11: 95,284,109	Y270H	probably damaging	Het
Kmt2b	A	G	7: 30,576,774	S1767P	probably damaging	Het
Lonp2	A	G	8: 86,634,909	D238G	probably benign	Het
Lrfn3	A	G	7: 30,360,024	W259R	probably damaging	Het
Mmrn2	G	A	14: 34,397,922	D250N	probably benign	Het
Mug1	T	C	6: 121,880,896	L1116P	possibly damaging	Het
Mup9	A	G	4: 60,418,203	S234P	probably benign	Het
Nlrp9c	A	G	7: 26,385,489	F222L	possibly damaging	Het
Nr2e3	A	G	9: 59,948,999	V85A	probably damaging	Het
Olfr1252	A	G	2: 89,722,000	I37T	probably benign	Het
Prl3d2	A	G	13: 27,123,966	T77A	probably benign	Het
Prpsap1	A	T	11: 116,490,216	M1K	probably null	Het
Prrc2b	C	T	2: 32,194,414	T297M	probably damaging	Het
Rasa3	A	G	8: 13,631,805	F48S	probably benign	Het
Rbm24	A	T	13: 46,419,031	M1L	possibly damaging	Het
Ren1	C	A	1: 133,354,866	T103K	probably damaging	Het
Rpf2	C	T	10: 40,223,884	G260S	probably damaging	Het
Sall4	C	T	2: 168,752,641	G862D	probably damaging	Het
Samd4	G	T	14: 47,064,247	R336L	probably damaging	Het
Siglec1	T	C	2: 131,071,163	N1611S	probably benign	Het
Skil	A	G	3: 31,097,602	H91R	possibly damaging	Het
Snip1	T	C	4: 125,071,381	V193A	probably benign	Het
Sp2	A	T	11: 96,961,837	I87N	probably damaging	Het
Syna	T	C	5: 134,559,192	H301R	probably benign	Het
Tdg	A	G	10: 82,641,382	K89R	possibly damaging	Het
Tdrd7	G	A	4: 46,010,902		probably null	Het
Trak1	G	A	9: 121,460,425	R601H	probably damaging	Het
Triobp	T	C	15: 78,959,944	L120P	probably damaging	Het
Utp20	A	T	10: 88,770,388	N1697K	probably benign	Het
Uts2r	G	A	11: 121,160,669	V120M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,832	L162P	probably damaging	Het
Zbtb17	G	A	4: 141,461,823	R18Q	probably damaging	Het
Zfp551	A	T	7: 12,417,211	C90*	probably null	Het
Zfp605	T	A	5: 110,128,434	C473S	probably damaging	Het
Zfp975	A	T	7: 42,662,932	Y86N	probably benign	Het

Other mutations in Mre11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Mre11a	APN	9	14825208	missense	probably benign	0.28
IGL00429:Mre11a	APN	9	14802813	missense	probably damaging	1.00
IGL00922:Mre11a	APN	9	14799588	missense	probably damaging	1.00
IGL01095:Mre11a	APN	9	14809824	missense	probably benign
IGL01294:Mre11a	APN	9	14830915	missense	probably damaging	0.97
IGL01871:Mre11a	APN	9	14811897	missense	possibly damaging	0.95
IGL02194:Mre11a	APN	9	14815209	missense	possibly damaging	0.70
IGL02213:Mre11a	APN	9	14811884	missense	probably damaging	1.00
IGL02245:Mre11a	APN	9	14815276	unclassified	probably benign
IGL02749:Mre11a	APN	9	14826591	missense	possibly damaging	0.78
IGL02812:Mre11a	APN	9	14790670	splice site	probably null
bow	UTSW	9	14786962	missense	probably damaging	1.00
R0050:Mre11a	UTSW	9	14830973	splice site	probably benign
R0594:Mre11a	UTSW	9	14815209	missense	probably benign	0.00
R1241:Mre11a	UTSW	9	14799639	missense	probably damaging	1.00
R1905:Mre11a	UTSW	9	14799627	missense	probably benign	0.08
R2030:Mre11a	UTSW	9	14795805	missense	probably damaging	1.00
R2270:Mre11a	UTSW	9	14815174	missense	probably benign	0.00
R2511:Mre11a	UTSW	9	14795769	critical splice acceptor site	probably null
R2851:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2852:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R2853:Mre11a	UTSW	9	14826547	missense	probably benign	0.00
R3765:Mre11a	UTSW	9	14809847	missense	probably benign	0.25
R4612:Mre11a	UTSW	9	14802903	missense	probably damaging	1.00
R5007:Mre11a	UTSW	9	14809820	missense	probably benign	0.10
R5343:Mre11a	UTSW	9	14811834	missense	probably damaging	0.98
R5679:Mre11a	UTSW	9	14786919	missense	probably damaging	0.99
R5834:Mre11a	UTSW	9	14799657	missense	probably benign	0.15
R5914:Mre11a	UTSW	9	14811936	missense	probably damaging	1.00
R5935:Mre11a	UTSW	9	14786962	missense	probably damaging	1.00
R6089:Mre11a	UTSW	9	14819464	missense	probably benign	0.02
R6393:Mre11a	UTSW	9	14785509	start codon destroyed	probably null	0.00
R6625:Mre11a	UTSW	9	14805391	missense	possibly damaging	0.52
R7248:Mre11a	UTSW	9	14811913	missense	possibly damaging	0.52
R7744:Mre11a	UTSW	9	14809832	missense	possibly damaging	0.94
R8179:Mre11a	UTSW	9	14797066	missense	probably null	1.00
R9293:Mre11a	UTSW	9	14799588	missense	probably damaging	1.00
R9302:Mre11a	UTSW	9	14785530	critical splice donor site	probably null
R9368:Mre11a	UTSW	9	14825218	missense	probably benign
R9410:Mre11a	UTSW	9	14805420	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTACCTTCTAAACCCACTGTAGG -3'
(R):5'- GCTGCTGCATCAATGTCTGTAC -3'

Sequencing Primer
(F):5'- CTTCTAAACCCACTGTAGGAAAAC -3'
(R):5'- GGCAAACGTTCGTTCACAAG -3'

Posted On

2020-01-23