Mutagenetix > Incidental Mutation

Incidental Mutation 'R7999:Trak1'

616272

Institutional Source

Beutler Lab

Gene Symbol

Trak1

Ensembl Gene

ENSMUSG00000032536

Gene Name

trafficking protein, kinesin binding 1

Synonyms

hyrt, 2310001H13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R7999 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

121297502-121474918 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 121460425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 601 (R601H)

Ref Sequence

ENSEMBL: ENSMUSP00000044482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045903] [ENSMUST00000210798] [ENSMUST00000211187] [ENSMUST00000211301] [ENSMUST00000211439]

AlphaFold

Q6PD31

Predicted Effect

probably damaging
Transcript: ENSMUST00000045903
AA Change: R601H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044482
Gene: ENSMUSG00000032536
AA Change: R601H

Domain	Start	End	E-Value	Type
Pfam:HAP1_N	47	352	8.1e-139	PFAM
Pfam:Milton	411	580	5e-72	PFAM
low complexity region	882	897	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000210798
AA Change: R498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211187
AA Change: R591H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211301
AA Change: R498H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000211439

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice with a spontaneous mutation in this allele have various behavioral abnormalities consistent with hypertonia. Inclusions can be found in neuronal processes of the gray matter of the brainstem and spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,737,452	V753L	probably benign	Het
Ahi1	A	G	10: 20,965,681	E289G	probably benign	Het
AI481877	G	C	4: 59,094,162	F187L	probably benign	Het
Armc2	C	T	10: 42,011,958	E10K	possibly damaging	Het
Aspscr1	T	C	11: 120,678,522		probably null	Het
B3galnt1	A	G	3: 69,575,215	C238R	probably damaging	Het
Bak1	A	G	17: 27,021,306	L129P	probably damaging	Het
Bdp1	A	G	13: 100,058,896	F1272L	possibly damaging	Het
C2cd3	G	A	7: 100,459,889		probably null	Het
Cacna1b	A	T	2: 24,650,626	V1363E	probably damaging	Het
Capn11	T	C	17: 45,639,206	N344S	probably damaging	Het
Ces1f	A	T	8: 93,262,995	V431E	possibly damaging	Het
Cog3	G	T	14: 75,747,093	S94Y	possibly damaging	Het
Defa29	A	T	8: 21,326,843	S45T	probably benign	Het
Dnah10	A	G	5: 124,725,258	D32G	probably benign	Het
Dnajc24	T	A	2: 105,981,020	N70I	probably damaging	Het
Duox2	C	T	2: 122,283,467	V1195I	probably benign	Het
E430018J23Rik	T	A	7: 127,392,428	S117C	probably damaging	Het
Enam	A	T	5: 88,503,702	R1023S	probably benign	Het
Ephx4	A	T	5: 107,419,833	Q219L	probably damaging	Het
Eppk1	T	C	15: 76,109,004	T1226A	probably benign	Het
Eppk1	T	C	15: 76,109,135	Q1182R	probably benign	Het
Fiz1	A	T	7: 5,008,998	S174T	probably benign	Het
Ggnbp1	C	T	17: 27,029,645	R63C	probably benign	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gsdmd	T	A	15: 75,863,446	I13N	probably damaging	Het
Gtpbp4	T	C	13: 8,987,286	D292G	probably damaging	Het
Hnf1a	A	T	5: 114,960,174	L123*	probably null	Het
Ints11	A	G	4: 155,886,956	D309G	probably benign	Het
Ints5	T	C	19: 8,897,043	S789P	probably benign	Het
Jakmip2	G	A	18: 43,563,333	A517V	probably benign	Het
Kat7	A	G	11: 95,284,109	Y270H	probably damaging	Het
Kmt2b	A	G	7: 30,576,774	S1767P	probably damaging	Het
Lonp2	A	G	8: 86,634,909	D238G	probably benign	Het
Lrfn3	A	G	7: 30,360,024	W259R	probably damaging	Het
Mmrn2	G	A	14: 34,397,922	D250N	probably benign	Het
Mre11a	A	T	9: 14,799,669	R49*	probably null	Het
Mug1	T	C	6: 121,880,896	L1116P	possibly damaging	Het
Mup9	A	G	4: 60,418,203	S234P	probably benign	Het
Nlrp9c	A	G	7: 26,385,489	F222L	possibly damaging	Het
Nr2e3	A	G	9: 59,948,999	V85A	probably damaging	Het
Olfr1252	A	G	2: 89,722,000	I37T	probably benign	Het
Prl3d2	A	G	13: 27,123,966	T77A	probably benign	Het
Prpsap1	A	T	11: 116,490,216	M1K	probably null	Het
Prrc2b	C	T	2: 32,194,414	T297M	probably damaging	Het
Rasa3	A	G	8: 13,631,805	F48S	probably benign	Het
Rbm24	A	T	13: 46,419,031	M1L	possibly damaging	Het
Ren1	C	A	1: 133,354,866	T103K	probably damaging	Het
Rpf2	C	T	10: 40,223,884	G260S	probably damaging	Het
Sall4	C	T	2: 168,752,641	G862D	probably damaging	Het
Samd4	G	T	14: 47,064,247	R336L	probably damaging	Het
Siglec1	T	C	2: 131,071,163	N1611S	probably benign	Het
Skil	A	G	3: 31,097,602	H91R	possibly damaging	Het
Snip1	T	C	4: 125,071,381	V193A	probably benign	Het
Sp2	A	T	11: 96,961,837	I87N	probably damaging	Het
Syna	T	C	5: 134,559,192	H301R	probably benign	Het
Tdg	A	G	10: 82,641,382	K89R	possibly damaging	Het
Tdrd7	G	A	4: 46,010,902		probably null	Het
Triobp	T	C	15: 78,959,944	L120P	probably damaging	Het
Utp20	A	T	10: 88,770,388	N1697K	probably benign	Het
Uts2r	G	A	11: 121,160,669	V120M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,832	L162P	probably damaging	Het
Zbtb17	G	A	4: 141,461,823	R18Q	probably damaging	Het
Zfp551	A	T	7: 12,417,211	C90*	probably null	Het
Zfp605	T	A	5: 110,128,434	C473S	probably damaging	Het
Zfp975	A	T	7: 42,662,932	Y86N	probably benign	Het

Other mutations in Trak1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Trak1	APN	9	121443736	critical splice donor site	probably null
IGL01335:Trak1	APN	9	121454316	missense	possibly damaging	0.58
IGL01777:Trak1	APN	9	121431560	splice site	probably null
IGL01804:Trak1	APN	9	121442685	splice site	probably benign
IGL01986:Trak1	APN	9	121472967	missense	probably benign	0.00
IGL02248:Trak1	APN	9	121446794	missense	probably damaging	1.00
IGL02276:Trak1	APN	9	121451668	missense	probably damaging	1.00
IGL02556:Trak1	APN	9	121448901	missense	probably damaging	1.00
IGL03368:Trak1	APN	9	121367122	missense	possibly damaging	0.66
PIT4468001:Trak1	UTSW	9	121453332	missense	probably benign	0.18
R0067:Trak1	UTSW	9	121472907	missense	probably damaging	1.00
R0276:Trak1	UTSW	9	121454338	missense	probably damaging	0.97
R0535:Trak1	UTSW	9	121443712	missense	probably null	1.00
R0629:Trak1	UTSW	9	121367167	missense	probably benign	0.37
R0671:Trak1	UTSW	9	121448955	critical splice donor site	probably null
R0883:Trak1	UTSW	9	121453285	missense	possibly damaging	0.90
R1160:Trak1	UTSW	9	121392007	missense	probably benign	0.01
R1162:Trak1	UTSW	9	121453341	missense	possibly damaging	0.93
R1168:Trak1	UTSW	9	121440679	missense	probably damaging	1.00
R1398:Trak1	UTSW	9	121454359	missense	probably damaging	1.00
R2118:Trak1	UTSW	9	121472997	makesense	probably null
R2119:Trak1	UTSW	9	121472997	makesense	probably null
R2120:Trak1	UTSW	9	121472997	makesense	probably null
R2137:Trak1	UTSW	9	121472962	missense	possibly damaging	0.83
R3162:Trak1	UTSW	9	121451734	splice site	probably benign
R3888:Trak1	UTSW	9	121442797	splice site	probably null
R3889:Trak1	UTSW	9	121445873	missense	probably null	0.40
R4031:Trak1	UTSW	9	121451670	missense	probably damaging	1.00
R4116:Trak1	UTSW	9	121448843	missense	probably damaging	1.00
R4406:Trak1	UTSW	9	121431536	missense	probably damaging	1.00
R4630:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4631:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4632:Trak1	UTSW	9	121454425	missense	probably benign	0.02
R4786:Trak1	UTSW	9	121472494	missense	probably benign	0.25
R5137:Trak1	UTSW	9	121367055	intron	probably benign
R5159:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R5467:Trak1	UTSW	9	121446798	missense	probably damaging	1.00
R5661:Trak1	UTSW	9	121443637	missense	possibly damaging	0.46
R5664:Trak1	UTSW	9	121472307	missense	possibly damaging	0.47
R5769:Trak1	UTSW	9	121448838	missense	probably damaging	1.00
R6041:Trak1	UTSW	9	121460412	missense	probably damaging	0.99
R6257:Trak1	UTSW	9	121446755	missense	probably damaging	1.00
R6257:Trak1	UTSW	9	121367224	missense	possibly damaging	0.92
R6354:Trak1	UTSW	9	121451726	missense	probably null	0.03
R6399:Trak1	UTSW	9	121453496	splice site	probably null
R6513:Trak1	UTSW	9	121443756	missense	probably benign
R6579:Trak1	UTSW	9	121443638	missense	probably benign	0.29
R6940:Trak1	UTSW	9	121443718	missense	possibly damaging	0.78
R7120:Trak1	UTSW	9	121460498	missense	probably benign
R7299:Trak1	UTSW	9	121451863	splice site	probably null
R7304:Trak1	UTSW	9	121416212	missense	probably benign
R7396:Trak1	UTSW	9	121448907	missense	possibly damaging	0.71
R7522:Trak1	UTSW	9	121442711	missense	probably damaging	0.99
R7657:Trak1	UTSW	9	121472586	missense	probably damaging	1.00
R7733:Trak1	UTSW	9	121367225	missense	possibly damaging	0.92
R7793:Trak1	UTSW	9	121416198	nonsense	probably null
R8209:Trak1	UTSW	9	121451727	missense	probably benign
R8215:Trak1	UTSW	9	121469030	missense	probably damaging	1.00
R8226:Trak1	UTSW	9	121451727	missense	probably benign
R8261:Trak1	UTSW	9	121451667	missense	probably damaging	1.00
R8300:Trak1	UTSW	9	121460499	nonsense	probably null
R8914:Trak1	UTSW	9	121443781	missense	unknown
R9072:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9073:Trak1	UTSW	9	121460488	missense	probably damaging	1.00
R9312:Trak1	UTSW	9	121451691	missense	probably benign	0.01
R9366:Trak1	UTSW	9	121472512	missense	probably damaging	1.00
R9663:Trak1	UTSW	9	121391858	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- ACAATCCTTTGCAAGCTCGG -3'
(R):5'- TGAGACAGTCACACGTGCTC -3'

Sequencing Primer
(F):5'- CTTTGCAAGCTCGGGTGAC -3'
(R):5'- AGTCACACGTGCTCGAGAC -3'

Posted On

2020-01-23