Incidental Mutation 'R7999:Ahi1'
ID616273
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R7999 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20965681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 289 (E289G)
Ref Sequence ENSEMBL: ENSMUSP00000101164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
Predicted Effect probably benign
Transcript: ENSMUST00000105525
AA Change: E289G

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: E289G

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213104
AA Change: E289G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,737,452 V753L probably benign Het
AI481877 G C 4: 59,094,162 F187L probably benign Het
Armc2 C T 10: 42,011,958 E10K possibly damaging Het
Aspscr1 T C 11: 120,678,522 probably null Het
B3galnt1 A G 3: 69,575,215 C238R probably damaging Het
Bak1 A G 17: 27,021,306 L129P probably damaging Het
Bdp1 A G 13: 100,058,896 F1272L possibly damaging Het
C2cd3 G A 7: 100,459,889 probably null Het
Cacna1b A T 2: 24,650,626 V1363E probably damaging Het
Capn11 T C 17: 45,639,206 N344S probably damaging Het
Ces1f A T 8: 93,262,995 V431E possibly damaging Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Defa29 A T 8: 21,326,843 S45T probably benign Het
Dnah10 A G 5: 124,725,258 D32G probably benign Het
Dnajc24 T A 2: 105,981,020 N70I probably damaging Het
Duox2 C T 2: 122,283,467 V1195I probably benign Het
E430018J23Rik T A 7: 127,392,428 S117C probably damaging Het
Enam A T 5: 88,503,702 R1023S probably benign Het
Ephx4 A T 5: 107,419,833 Q219L probably damaging Het
Eppk1 T C 15: 76,109,004 T1226A probably benign Het
Eppk1 T C 15: 76,109,135 Q1182R probably benign Het
Fiz1 A T 7: 5,008,998 S174T probably benign Het
Ggnbp1 C T 17: 27,029,645 R63C probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsdmd T A 15: 75,863,446 I13N probably damaging Het
Gtpbp4 T C 13: 8,987,286 D292G probably damaging Het
Hnf1a A T 5: 114,960,174 L123* probably null Het
Ints11 A G 4: 155,886,956 D309G probably benign Het
Ints5 T C 19: 8,897,043 S789P probably benign Het
Jakmip2 G A 18: 43,563,333 A517V probably benign Het
Kat7 A G 11: 95,284,109 Y270H probably damaging Het
Kmt2b A G 7: 30,576,774 S1767P probably damaging Het
Lonp2 A G 8: 86,634,909 D238G probably benign Het
Lrfn3 A G 7: 30,360,024 W259R probably damaging Het
Mmrn2 G A 14: 34,397,922 D250N probably benign Het
Mre11a A T 9: 14,799,669 R49* probably null Het
Mug1 T C 6: 121,880,896 L1116P possibly damaging Het
Mup9 A G 4: 60,418,203 S234P probably benign Het
Nlrp9c A G 7: 26,385,489 F222L possibly damaging Het
Nr2e3 A G 9: 59,948,999 V85A probably damaging Het
Olfr1252 A G 2: 89,722,000 I37T probably benign Het
Prl3d2 A G 13: 27,123,966 T77A probably benign Het
Prpsap1 A T 11: 116,490,216 M1K probably null Het
Prrc2b C T 2: 32,194,414 T297M probably damaging Het
Rasa3 A G 8: 13,631,805 F48S probably benign Het
Rbm24 A T 13: 46,419,031 M1L possibly damaging Het
Ren1 C A 1: 133,354,866 T103K probably damaging Het
Rpf2 C T 10: 40,223,884 G260S probably damaging Het
Sall4 C T 2: 168,752,641 G862D probably damaging Het
Samd4 G T 14: 47,064,247 R336L probably damaging Het
Siglec1 T C 2: 131,071,163 N1611S probably benign Het
Skil A G 3: 31,097,602 H91R possibly damaging Het
Snip1 T C 4: 125,071,381 V193A probably benign Het
Sp2 A T 11: 96,961,837 I87N probably damaging Het
Syna T C 5: 134,559,192 H301R probably benign Het
Tdg A G 10: 82,641,382 K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 probably null Het
Trak1 G A 9: 121,460,425 R601H probably damaging Het
Triobp T C 15: 78,959,944 L120P probably damaging Het
Utp20 A T 10: 88,770,388 N1697K probably benign Het
Uts2r G A 11: 121,160,669 V120M possibly damaging Het
Vmn2r59 A G 7: 42,046,832 L162P probably damaging Het
Zbtb17 G A 4: 141,461,823 R18Q probably damaging Het
Zfp551 A T 7: 12,417,211 C90* probably null Het
Zfp605 T A 5: 110,128,434 C473S probably damaging Het
Zfp975 A T 7: 42,662,932 Y86N probably benign Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
arisen UTSW 10 21007768 missense possibly damaging 0.53
urspringt UTSW 10 20984393 missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R2862:Ahi1 UTSW 10 20981408 missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4755:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R5969:Ahi1 UTSW 10 20984393 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6240:Ahi1 UTSW 10 20977081 missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20963750 missense probably benign 0.35
R7680:Ahi1 UTSW 10 21007768 missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20981431 critical splice donor site probably null
R8219:Ahi1 UTSW 10 21074436 missense probably benign 0.00
R8248:Ahi1 UTSW 10 20972092 missense probably benign 0.04
R8560:Ahi1 UTSW 10 20959915 missense probably benign 0.04
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21041007 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGAACAGTGAACGTCCTGTTTC -3'
(R):5'- AAGCCACACTCTTGGTTTTGAAC -3'

Sequencing Primer
(F):5'- TGAACGTCCTGTTTCATCTTATTATG -3'
(R):5'- CCATGCTTAAAAAGTCAAGAATCTG -3'
Posted On2020-01-23