Mutagenetix > Incidental Mutation

Incidental Mutation 'R7999:Bdp1'

616287

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7999 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100058896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1272 (F1272L)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

AlphaFold

Q571C7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038104
AA Change: F1272L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: F1272L

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099262

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109379
AA Change: F1272L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: F1272L

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930402H24Rik	C	A	2: 130,737,452	V753L	probably benign	Het
Ahi1	A	G	10: 20,965,681	E289G	probably benign	Het
AI481877	G	C	4: 59,094,162	F187L	probably benign	Het
Armc2	C	T	10: 42,011,958	E10K	possibly damaging	Het
Aspscr1	T	C	11: 120,678,522		probably null	Het
B3galnt1	A	G	3: 69,575,215	C238R	probably damaging	Het
Bak1	A	G	17: 27,021,306	L129P	probably damaging	Het
C2cd3	G	A	7: 100,459,889		probably null	Het
Cacna1b	A	T	2: 24,650,626	V1363E	probably damaging	Het
Capn11	T	C	17: 45,639,206	N344S	probably damaging	Het
Ces1f	A	T	8: 93,262,995	V431E	possibly damaging	Het
Cog3	G	T	14: 75,747,093	S94Y	possibly damaging	Het
Defa29	A	T	8: 21,326,843	S45T	probably benign	Het
Dnah10	A	G	5: 124,725,258	D32G	probably benign	Het
Dnajc24	T	A	2: 105,981,020	N70I	probably damaging	Het
Duox2	C	T	2: 122,283,467	V1195I	probably benign	Het
E430018J23Rik	T	A	7: 127,392,428	S117C	probably damaging	Het
Enam	A	T	5: 88,503,702	R1023S	probably benign	Het
Ephx4	A	T	5: 107,419,833	Q219L	probably damaging	Het
Eppk1	T	C	15: 76,109,004	T1226A	probably benign	Het
Eppk1	T	C	15: 76,109,135	Q1182R	probably benign	Het
Fiz1	A	T	7: 5,008,998	S174T	probably benign	Het
Ggnbp1	C	T	17: 27,029,645	R63C	probably benign	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gsdmd	T	A	15: 75,863,446	I13N	probably damaging	Het
Gtpbp4	T	C	13: 8,987,286	D292G	probably damaging	Het
Hnf1a	A	T	5: 114,960,174	L123*	probably null	Het
Ints11	A	G	4: 155,886,956	D309G	probably benign	Het
Ints5	T	C	19: 8,897,043	S789P	probably benign	Het
Jakmip2	G	A	18: 43,563,333	A517V	probably benign	Het
Kat7	A	G	11: 95,284,109	Y270H	probably damaging	Het
Kmt2b	A	G	7: 30,576,774	S1767P	probably damaging	Het
Lonp2	A	G	8: 86,634,909	D238G	probably benign	Het
Lrfn3	A	G	7: 30,360,024	W259R	probably damaging	Het
Mmrn2	G	A	14: 34,397,922	D250N	probably benign	Het
Mre11a	A	T	9: 14,799,669	R49*	probably null	Het
Mug1	T	C	6: 121,880,896	L1116P	possibly damaging	Het
Mup9	A	G	4: 60,418,203	S234P	probably benign	Het
Nlrp9c	A	G	7: 26,385,489	F222L	possibly damaging	Het
Nr2e3	A	G	9: 59,948,999	V85A	probably damaging	Het
Olfr1252	A	G	2: 89,722,000	I37T	probably benign	Het
Prl3d2	A	G	13: 27,123,966	T77A	probably benign	Het
Prpsap1	A	T	11: 116,490,216	M1K	probably null	Het
Prrc2b	C	T	2: 32,194,414	T297M	probably damaging	Het
Rasa3	A	G	8: 13,631,805	F48S	probably benign	Het
Rbm24	A	T	13: 46,419,031	M1L	possibly damaging	Het
Ren1	C	A	1: 133,354,866	T103K	probably damaging	Het
Rpf2	C	T	10: 40,223,884	G260S	probably damaging	Het
Sall4	C	T	2: 168,752,641	G862D	probably damaging	Het
Samd4	G	T	14: 47,064,247	R336L	probably damaging	Het
Siglec1	T	C	2: 131,071,163	N1611S	probably benign	Het
Skil	A	G	3: 31,097,602	H91R	possibly damaging	Het
Snip1	T	C	4: 125,071,381	V193A	probably benign	Het
Sp2	A	T	11: 96,961,837	I87N	probably damaging	Het
Syna	T	C	5: 134,559,192	H301R	probably benign	Het
Tdg	A	G	10: 82,641,382	K89R	possibly damaging	Het
Tdrd7	G	A	4: 46,010,902		probably null	Het
Trak1	G	A	9: 121,460,425	R601H	probably damaging	Het
Triobp	T	C	15: 78,959,944	L120P	probably damaging	Het
Utp20	A	T	10: 88,770,388	N1697K	probably benign	Het
Uts2r	G	A	11: 121,160,669	V120M	possibly damaging	Het
Vmn2r59	A	G	7: 42,046,832	L162P	probably damaging	Het
Zbtb17	G	A	4: 141,461,823	R18Q	probably damaging	Het
Zfp551	A	T	7: 12,417,211	C90*	probably null	Het
Zfp605	T	A	5: 110,128,434	C473S	probably damaging	Het
Zfp975	A	T	7: 42,662,932	Y86N	probably benign	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5909:Bdp1	UTSW	13	100092286	missense	probably benign	0.08
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7975:Bdp1	UTSW	13	100020376	missense	probably benign	0.01
R8126:Bdp1	UTSW	13	100056282	missense	probably damaging	1.00
R8340:Bdp1	UTSW	13	100065968	missense	possibly damaging	0.61
R8414:Bdp1	UTSW	13	100064477	missense	probably benign	0.03
R8468:Bdp1	UTSW	13	100060568	missense	probably benign	0.04
R8688:Bdp1	UTSW	13	100103799	missense	probably damaging	1.00
R8871:Bdp1	UTSW	13	100049667	missense	probably damaging	1.00
R8976:Bdp1	UTSW	13	100060899	nonsense	probably null
R8987:Bdp1	UTSW	13	100067513	missense	probably benign	0.01
R9157:Bdp1	UTSW	13	100049928	missense	probably benign	0.40
R9437:Bdp1	UTSW	13	100025650	missense	probably benign	0.31
R9612:Bdp1	UTSW	13	100077862	missense	probably benign	0.18
R9679:Bdp1	UTSW	13	100043777	missense	probably damaging	0.98
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31
Z1177:Bdp1	UTSW	13	100061396	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACGGTAAGCATAGAACACC -3'
(R):5'- CCTGGATTGTTCAACTCGGTG -3'

Sequencing Primer
(F):5'- GGTAAGCATAGAACACCATCCATG -3'
(R):5'- CACAGTCCCCATAATTGTTAGGTGG -3'

Posted On

2020-01-23