Incidental Mutation 'R7999:Bdp1'
ID 616287
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene Name B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms Tfnr, TFIIIB90, TFC5, B130055N23Rik, TAF3B1, TFIIIB150, G630013P12Rik
MMRRC Submission 046039-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7999 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 100154502-100240578 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100195404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1272 (F1272L)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
AlphaFold Q571C7
Predicted Effect possibly damaging
Transcript: ENSMUST00000038104
AA Change: F1272L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: F1272L

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect possibly damaging
Transcript: ENSMUST00000109379
AA Change: F1272L

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: F1272L

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,841,580 (GRCm39) E289G probably benign Het
Armc2 C T 10: 41,887,954 (GRCm39) E10K possibly damaging Het
Aspscr1 T C 11: 120,569,348 (GRCm39) probably null Het
B3galnt1 A G 3: 69,482,548 (GRCm39) C238R probably damaging Het
Bak1 A G 17: 27,240,280 (GRCm39) L129P probably damaging Het
C2cd3 G A 7: 100,109,096 (GRCm39) probably null Het
Cacna1b A T 2: 24,540,638 (GRCm39) V1363E probably damaging Het
Capn11 T C 17: 45,950,132 (GRCm39) N344S probably damaging Het
Ces1f A T 8: 93,989,623 (GRCm39) V431E possibly damaging Het
Cog3 G T 14: 75,984,533 (GRCm39) S94Y possibly damaging Het
Defa29 A T 8: 21,816,859 (GRCm39) S45T probably benign Het
Dnaaf9 C A 2: 130,579,372 (GRCm39) V753L probably benign Het
Dnah10 A G 5: 124,802,322 (GRCm39) D32G probably benign Het
Dnajc24 T A 2: 105,811,365 (GRCm39) N70I probably damaging Het
Duox2 C T 2: 122,113,948 (GRCm39) V1195I probably benign Het
Enam A T 5: 88,651,561 (GRCm39) R1023S probably benign Het
Ephx4 A T 5: 107,567,699 (GRCm39) Q219L probably damaging Het
Eppk1 T C 15: 75,993,204 (GRCm39) T1226A probably benign Het
Eppk1 T C 15: 75,993,335 (GRCm39) Q1182R probably benign Het
Fiz1 A T 7: 5,011,997 (GRCm39) S174T probably benign Het
Ggnbp1 C T 17: 27,248,619 (GRCm39) R63C probably benign Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Gsdmd T A 15: 75,735,295 (GRCm39) I13N probably damaging Het
Gtpbp4 T C 13: 9,037,322 (GRCm39) D292G probably damaging Het
Hnf1a A T 5: 115,098,233 (GRCm39) L123* probably null Het
Ints11 A G 4: 155,971,413 (GRCm39) D309G probably benign Het
Ints5 T C 19: 8,874,407 (GRCm39) S789P probably benign Het
Jakmip2 G A 18: 43,696,398 (GRCm39) A517V probably benign Het
Kat7 A G 11: 95,174,935 (GRCm39) Y270H probably damaging Het
Kmt2b A G 7: 30,276,199 (GRCm39) S1767P probably damaging Het
Lonp2 A G 8: 87,361,537 (GRCm39) D238G probably benign Het
Lrfn3 A G 7: 30,059,449 (GRCm39) W259R probably damaging Het
Mmrn2 G A 14: 34,119,879 (GRCm39) D250N probably benign Het
Mre11a A T 9: 14,710,965 (GRCm39) R49* probably null Het
Mug1 T C 6: 121,857,855 (GRCm39) L1116P possibly damaging Het
Mup9 A G 4: 60,374,202 (GRCm39) S234P probably benign Het
Nlrp9c A G 7: 26,084,914 (GRCm39) F222L possibly damaging Het
Nr2e3 A G 9: 59,856,282 (GRCm39) V85A probably damaging Het
Or4a79 A G 2: 89,552,344 (GRCm39) I37T probably benign Het
Prl3d2 A G 13: 27,307,949 (GRCm39) T77A probably benign Het
Prpsap1 A T 11: 116,381,042 (GRCm39) M1K probably null Het
Prrc2b C T 2: 32,084,426 (GRCm39) T297M probably damaging Het
Rasa3 A G 8: 13,681,805 (GRCm39) F48S probably benign Het
Rbm24 A T 13: 46,572,507 (GRCm39) M1L possibly damaging Het
Ren1 C A 1: 133,282,604 (GRCm39) T103K probably damaging Het
Rpf2 C T 10: 40,099,880 (GRCm39) G260S probably damaging Het
Sall4 C T 2: 168,594,561 (GRCm39) G862D probably damaging Het
Samd4 G T 14: 47,301,704 (GRCm39) R336L probably damaging Het
Shoc1 G C 4: 59,094,162 (GRCm39) F187L probably benign Het
Siglec1 T C 2: 130,913,083 (GRCm39) N1611S probably benign Het
Skil A G 3: 31,151,751 (GRCm39) H91R possibly damaging Het
Snip1 T C 4: 124,965,174 (GRCm39) V193A probably benign Het
Sp2 A T 11: 96,852,663 (GRCm39) I87N probably damaging Het
Syna T C 5: 134,588,046 (GRCm39) H301R probably benign Het
Tdg A G 10: 82,477,216 (GRCm39) K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 (GRCm39) probably null Het
Trak1 G A 9: 121,289,491 (GRCm39) R601H probably damaging Het
Triobp T C 15: 78,844,144 (GRCm39) L120P probably damaging Het
Utp20 A T 10: 88,606,250 (GRCm39) N1697K probably benign Het
Uts2r G A 11: 121,051,495 (GRCm39) V120M possibly damaging Het
Vmn2r59 A G 7: 41,696,256 (GRCm39) L162P probably damaging Het
Zbtb17 G A 4: 141,189,134 (GRCm39) R18Q probably damaging Het
Zfp551 A T 7: 12,151,138 (GRCm39) C90* probably null Het
Zfp605 T A 5: 110,276,300 (GRCm39) C473S probably damaging Het
Zfp764l1 T A 7: 126,991,600 (GRCm39) S117C probably damaging Het
Zfp975 A T 7: 42,312,356 (GRCm39) Y86N probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100,235,018 (GRCm39) missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100,197,373 (GRCm39) missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100,197,706 (GRCm39) missense probably benign 0.00
IGL00924:Bdp1 APN 13 100,234,087 (GRCm39) missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100,192,700 (GRCm39) missense probably benign 0.00
IGL01344:Bdp1 APN 13 100,214,588 (GRCm39) missense probably benign 0.06
IGL01347:Bdp1 APN 13 100,206,711 (GRCm39) missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100,220,713 (GRCm39) splice site probably benign
IGL01871:Bdp1 APN 13 100,202,561 (GRCm39) missense probably benign 0.01
IGL02008:Bdp1 APN 13 100,160,335 (GRCm39) missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100,174,308 (GRCm39) missense probably benign 0.02
IGL02214:Bdp1 APN 13 100,178,043 (GRCm39) missense probably benign 0.00
IGL02236:Bdp1 APN 13 100,197,399 (GRCm39) missense probably benign
IGL02307:Bdp1 APN 13 100,229,946 (GRCm39) missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100,191,816 (GRCm39) splice site probably benign
IGL02415:Bdp1 APN 13 100,225,916 (GRCm39) missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100,235,022 (GRCm39) missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100,214,623 (GRCm39) critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100,188,047 (GRCm39) missense probably benign 0.29
IGL02738:Bdp1 APN 13 100,187,861 (GRCm39) missense probably benign 0.26
IGL02754:Bdp1 APN 13 100,197,481 (GRCm39) missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100,178,778 (GRCm39) missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100,191,800 (GRCm39) missense probably benign 0.00
IGL03156:Bdp1 APN 13 100,197,544 (GRCm39) missense probably benign 0.44
IGL03166:Bdp1 APN 13 100,172,308 (GRCm39) missense probably benign 0.28
IGL03232:Bdp1 APN 13 100,187,989 (GRCm39) missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100,160,129 (GRCm39) missense probably benign 0.02
R0115:Bdp1 UTSW 13 100,177,962 (GRCm39) missense probably benign 0.28
R0481:Bdp1 UTSW 13 100,177,962 (GRCm39) missense probably benign 0.28
R0619:Bdp1 UTSW 13 100,174,366 (GRCm39) missense probably benign 0.00
R0730:Bdp1 UTSW 13 100,195,459 (GRCm39) splice site probably benign
R0744:Bdp1 UTSW 13 100,172,333 (GRCm39) missense probably benign 0.01
R0833:Bdp1 UTSW 13 100,172,333 (GRCm39) missense probably benign 0.01
R1307:Bdp1 UTSW 13 100,186,271 (GRCm39) missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100,235,516 (GRCm39) missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100,215,263 (GRCm39) nonsense probably null
R1644:Bdp1 UTSW 13 100,197,448 (GRCm39) missense probably benign 0.03
R1670:Bdp1 UTSW 13 100,163,941 (GRCm39) critical splice donor site probably null
R1836:Bdp1 UTSW 13 100,171,653 (GRCm39) missense probably benign
R1869:Bdp1 UTSW 13 100,178,709 (GRCm39) missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100,235,097 (GRCm39) missense probably benign 0.30
R1944:Bdp1 UTSW 13 100,210,889 (GRCm39) splice site probably null
R2030:Bdp1 UTSW 13 100,197,697 (GRCm39) missense probably benign 0.00
R2069:Bdp1 UTSW 13 100,187,496 (GRCm39) missense probably benign 0.00
R2180:Bdp1 UTSW 13 100,197,913 (GRCm39) small insertion probably benign
R2263:Bdp1 UTSW 13 100,202,545 (GRCm39) missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100,197,847 (GRCm39) missense probably damaging 1.00
R2277:Bdp1 UTSW 13 100,197,838 (GRCm39) missense probably benign 0.05
R2278:Bdp1 UTSW 13 100,197,847 (GRCm39) missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100,197,838 (GRCm39) missense probably benign 0.05
R2336:Bdp1 UTSW 13 100,189,510 (GRCm39) missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100,196,878 (GRCm39) missense probably benign 0.08
R3154:Bdp1 UTSW 13 100,186,322 (GRCm39) missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100,196,093 (GRCm39) missense probably benign
R4322:Bdp1 UTSW 13 100,228,731 (GRCm39) missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100,167,369 (GRCm39) missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100,167,369 (GRCm39) missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100,192,775 (GRCm39) missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100,186,376 (GRCm39) missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100,187,627 (GRCm39) missense probably benign 0.26
R4914:Bdp1 UTSW 13 100,192,844 (GRCm39) missense probably benign 0.28
R4917:Bdp1 UTSW 13 100,191,713 (GRCm39) missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100,191,713 (GRCm39) missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100,167,302 (GRCm39) nonsense probably null
R5266:Bdp1 UTSW 13 100,204,043 (GRCm39) missense probably benign 0.33
R5312:Bdp1 UTSW 13 100,234,109 (GRCm39) splice site probably null
R5420:Bdp1 UTSW 13 100,202,551 (GRCm39) missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100,235,018 (GRCm39) missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100,228,794 (GRCm39) missense probably benign 0.08
R5913:Bdp1 UTSW 13 100,187,612 (GRCm39) missense probably benign 0.41
R6018:Bdp1 UTSW 13 100,174,732 (GRCm39) missense probably benign 0.00
R6037:Bdp1 UTSW 13 100,163,957 (GRCm39) missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100,163,957 (GRCm39) missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100,162,036 (GRCm39) missense probably benign 0.00
R6969:Bdp1 UTSW 13 100,211,039 (GRCm39) missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100,174,269 (GRCm39) missense probably null 1.00
R6996:Bdp1 UTSW 13 100,180,321 (GRCm39) missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100,215,215 (GRCm39) missense probably benign 0.03
R7060:Bdp1 UTSW 13 100,196,002 (GRCm39) missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100,206,689 (GRCm39) missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100,197,659 (GRCm39) missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100,186,478 (GRCm39) missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100,186,478 (GRCm39) missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100,178,040 (GRCm39) missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100,187,457 (GRCm39) missense probably benign 0.03
R7562:Bdp1 UTSW 13 100,162,049 (GRCm39) missense probably benign 0.04
R7583:Bdp1 UTSW 13 100,186,320 (GRCm39) missense probably damaging 1.00
R7788:Bdp1 UTSW 13 100,191,759 (GRCm39) missense possibly damaging 0.64
R7842:Bdp1 UTSW 13 100,235,637 (GRCm39) missense probably damaging 1.00
R7850:Bdp1 UTSW 13 100,228,832 (GRCm39) missense probably damaging 1.00
R7904:Bdp1 UTSW 13 100,177,944 (GRCm39) missense probably benign 0.37
R7975:Bdp1 UTSW 13 100,156,884 (GRCm39) missense probably benign 0.01
R8126:Bdp1 UTSW 13 100,192,790 (GRCm39) missense probably damaging 1.00
R8340:Bdp1 UTSW 13 100,202,476 (GRCm39) missense possibly damaging 0.61
R8414:Bdp1 UTSW 13 100,200,985 (GRCm39) missense probably benign 0.03
R8468:Bdp1 UTSW 13 100,197,076 (GRCm39) missense probably benign 0.04
R8688:Bdp1 UTSW 13 100,240,307 (GRCm39) missense probably damaging 1.00
R8871:Bdp1 UTSW 13 100,186,175 (GRCm39) missense probably damaging 1.00
R8976:Bdp1 UTSW 13 100,197,407 (GRCm39) nonsense probably null
R8987:Bdp1 UTSW 13 100,204,021 (GRCm39) missense probably benign 0.01
R9157:Bdp1 UTSW 13 100,186,436 (GRCm39) missense probably benign 0.40
R9437:Bdp1 UTSW 13 100,162,158 (GRCm39) missense probably benign 0.31
R9612:Bdp1 UTSW 13 100,214,370 (GRCm39) missense probably benign 0.18
R9679:Bdp1 UTSW 13 100,180,285 (GRCm39) missense probably damaging 0.98
RF003:Bdp1 UTSW 13 100,196,958 (GRCm39) missense probably benign 0.31
RF003:Bdp1 UTSW 13 100,196,957 (GRCm39) missense probably benign 0.31
Z1177:Bdp1 UTSW 13 100,197,904 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACGGTAAGCATAGAACACC -3'
(R):5'- CCTGGATTGTTCAACTCGGTG -3'

Sequencing Primer
(F):5'- GGTAAGCATAGAACACCATCCATG -3'
(R):5'- CACAGTCCCCATAATTGTTAGGTGG -3'
Posted On 2020-01-23