Incidental Mutation 'R7999:Samd4'
ID616289
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R7999 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47064247 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 336 (R336L)
Ref Sequence ENSEMBL: ENSMUSP00000022386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000125688] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect probably damaging
Transcript: ENSMUST00000022386
AA Change: R336L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838
AA Change: R336L

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100672
AA Change: R248L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838
AA Change: R248L

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125113
AA Change: R235L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838
AA Change: R235L

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125688
SMART Domains Protein: ENSMUSP00000115569
Gene: ENSMUSG00000021838

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137543
AA Change: R248L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838
AA Change: R248L

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000228404
AA Change: R147L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,737,452 V753L probably benign Het
Ahi1 A G 10: 20,965,681 E289G probably benign Het
AI481877 G C 4: 59,094,162 F187L probably benign Het
Armc2 C T 10: 42,011,958 E10K possibly damaging Het
Aspscr1 T C 11: 120,678,522 probably null Het
B3galnt1 A G 3: 69,575,215 C238R probably damaging Het
Bak1 A G 17: 27,021,306 L129P probably damaging Het
Bdp1 A G 13: 100,058,896 F1272L possibly damaging Het
C2cd3 G A 7: 100,459,889 probably null Het
Cacna1b A T 2: 24,650,626 V1363E probably damaging Het
Capn11 T C 17: 45,639,206 N344S probably damaging Het
Ces1f A T 8: 93,262,995 V431E possibly damaging Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Defa29 A T 8: 21,326,843 S45T probably benign Het
Dnah10 A G 5: 124,725,258 D32G probably benign Het
Dnajc24 T A 2: 105,981,020 N70I probably damaging Het
Duox2 C T 2: 122,283,467 V1195I probably benign Het
E430018J23Rik T A 7: 127,392,428 S117C probably damaging Het
Enam A T 5: 88,503,702 R1023S probably benign Het
Ephx4 A T 5: 107,419,833 Q219L probably damaging Het
Eppk1 T C 15: 76,109,004 T1226A probably benign Het
Eppk1 T C 15: 76,109,135 Q1182R probably benign Het
Fiz1 A T 7: 5,008,998 S174T probably benign Het
Ggnbp1 C T 17: 27,029,645 R63C probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsdmd T A 15: 75,863,446 I13N probably damaging Het
Gtpbp4 T C 13: 8,987,286 D292G probably damaging Het
Hnf1a A T 5: 114,960,174 L123* probably null Het
Ints11 A G 4: 155,886,956 D309G probably benign Het
Ints5 T C 19: 8,897,043 S789P probably benign Het
Jakmip2 G A 18: 43,563,333 A517V probably benign Het
Kat7 A G 11: 95,284,109 Y270H probably damaging Het
Kmt2b A G 7: 30,576,774 S1767P probably damaging Het
Lonp2 A G 8: 86,634,909 D238G probably benign Het
Lrfn3 A G 7: 30,360,024 W259R probably damaging Het
Mmrn2 G A 14: 34,397,922 D250N probably benign Het
Mre11a A T 9: 14,799,669 R49* probably null Het
Mug1 T C 6: 121,880,896 L1116P possibly damaging Het
Mup9 A G 4: 60,418,203 S234P probably benign Het
Nlrp9c A G 7: 26,385,489 F222L possibly damaging Het
Nr2e3 A G 9: 59,948,999 V85A probably damaging Het
Olfr1252 A G 2: 89,722,000 I37T probably benign Het
Prl3d2 A G 13: 27,123,966 T77A probably benign Het
Prpsap1 A T 11: 116,490,216 M1K probably null Het
Prrc2b C T 2: 32,194,414 T297M probably damaging Het
Rasa3 A G 8: 13,631,805 F48S probably benign Het
Rbm24 A T 13: 46,419,031 M1L possibly damaging Het
Ren1 C A 1: 133,354,866 T103K probably damaging Het
Rpf2 C T 10: 40,223,884 G260S probably damaging Het
Sall4 C T 2: 168,752,641 G862D probably damaging Het
Siglec1 T C 2: 131,071,163 N1611S probably benign Het
Skil A G 3: 31,097,602 H91R possibly damaging Het
Snip1 T C 4: 125,071,381 V193A probably benign Het
Sp2 A T 11: 96,961,837 I87N probably damaging Het
Syna T C 5: 134,559,192 H301R probably benign Het
Tdg A G 10: 82,641,382 K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 probably null Het
Trak1 G A 9: 121,460,425 R601H probably damaging Het
Triobp T C 15: 78,959,944 L120P probably damaging Het
Utp20 A T 10: 88,770,388 N1697K probably benign Het
Uts2r G A 11: 121,160,669 V120M possibly damaging Het
Vmn2r59 A G 7: 42,046,832 L162P probably damaging Het
Zbtb17 G A 4: 141,461,823 R18Q probably damaging Het
Zfp551 A T 7: 12,417,211 C90* probably null Het
Zfp605 T A 5: 110,128,434 C473S probably damaging Het
Zfp975 A T 7: 42,662,932 Y86N probably benign Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1247:Samd4 UTSW 14 47087758 small insertion probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4155:Samd4 UTSW 14 47052946 missense possibly damaging 0.74
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4658:Samd4 UTSW 14 47064246 missense probably damaging 1.00
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5432:Samd4 UTSW 14 47074062 missense probably benign 0.09
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R6944:Samd4 UTSW 14 47016635 missense possibly damaging 0.94
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
R7467:Samd4 UTSW 14 47087856 missense probably benign 0.19
R8301:Samd4 UTSW 14 47016678 missense probably benign
R8306:Samd4 UTSW 14 46884917 missense probably damaging 1.00
R8351:Samd4 UTSW 14 47101431 missense probably damaging 1.00
R8451:Samd4 UTSW 14 47101431 missense probably damaging 1.00
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGCCATCAGTTGCTACC -3'
(R):5'- CTAGTTTACTCACCGTGGGAC -3'

Sequencing Primer
(F):5'- GCCATCAGTTGCTACCTAAGTTAAG -3'
(R):5'- TCCTAGATCCGGGCAAGCTATG -3'
Posted On2020-01-23