Incidental Mutation 'R7999:Triobp'
ID616294
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7999 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78959944 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 120 (L120P)
Ref Sequence ENSEMBL: ENSMUSP00000105312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228] [ENSMUST00000229943]
Predicted Effect probably damaging
Transcript: ENSMUST00000109689
AA Change: L120P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: L120P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109690
AA Change: L120P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: L120P

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000140228
AA Change: L120P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000229943
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik C A 2: 130,737,452 V753L probably benign Het
Ahi1 A G 10: 20,965,681 E289G probably benign Het
AI481877 G C 4: 59,094,162 F187L probably benign Het
Armc2 C T 10: 42,011,958 E10K possibly damaging Het
Aspscr1 T C 11: 120,678,522 probably null Het
B3galnt1 A G 3: 69,575,215 C238R probably damaging Het
Bak1 A G 17: 27,021,306 L129P probably damaging Het
Bdp1 A G 13: 100,058,896 F1272L possibly damaging Het
C2cd3 G A 7: 100,459,889 probably null Het
Cacna1b A T 2: 24,650,626 V1363E probably damaging Het
Capn11 T C 17: 45,639,206 N344S probably damaging Het
Ces1f A T 8: 93,262,995 V431E possibly damaging Het
Cog3 G T 14: 75,747,093 S94Y possibly damaging Het
Defa29 A T 8: 21,326,843 S45T probably benign Het
Dnah10 A G 5: 124,725,258 D32G probably benign Het
Dnajc24 T A 2: 105,981,020 N70I probably damaging Het
Duox2 C T 2: 122,283,467 V1195I probably benign Het
E430018J23Rik T A 7: 127,392,428 S117C probably damaging Het
Enam A T 5: 88,503,702 R1023S probably benign Het
Ephx4 A T 5: 107,419,833 Q219L probably damaging Het
Eppk1 T C 15: 76,109,004 T1226A probably benign Het
Eppk1 T C 15: 76,109,135 Q1182R probably benign Het
Fiz1 A T 7: 5,008,998 S174T probably benign Het
Ggnbp1 C T 17: 27,029,645 R63C probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Gsdmd T A 15: 75,863,446 I13N probably damaging Het
Gtpbp4 T C 13: 8,987,286 D292G probably damaging Het
Hnf1a A T 5: 114,960,174 L123* probably null Het
Ints11 A G 4: 155,886,956 D309G probably benign Het
Ints5 T C 19: 8,897,043 S789P probably benign Het
Jakmip2 G A 18: 43,563,333 A517V probably benign Het
Kat7 A G 11: 95,284,109 Y270H probably damaging Het
Kmt2b A G 7: 30,576,774 S1767P probably damaging Het
Lonp2 A G 8: 86,634,909 D238G probably benign Het
Lrfn3 A G 7: 30,360,024 W259R probably damaging Het
Mmrn2 G A 14: 34,397,922 D250N probably benign Het
Mre11a A T 9: 14,799,669 R49* probably null Het
Mug1 T C 6: 121,880,896 L1116P possibly damaging Het
Mup9 A G 4: 60,418,203 S234P probably benign Het
Nlrp9c A G 7: 26,385,489 F222L possibly damaging Het
Nr2e3 A G 9: 59,948,999 V85A probably damaging Het
Olfr1252 A G 2: 89,722,000 I37T probably benign Het
Prl3d2 A G 13: 27,123,966 T77A probably benign Het
Prpsap1 A T 11: 116,490,216 M1K probably null Het
Prrc2b C T 2: 32,194,414 T297M probably damaging Het
Rasa3 A G 8: 13,631,805 F48S probably benign Het
Rbm24 A T 13: 46,419,031 M1L possibly damaging Het
Ren1 C A 1: 133,354,866 T103K probably damaging Het
Rpf2 C T 10: 40,223,884 G260S probably damaging Het
Sall4 C T 2: 168,752,641 G862D probably damaging Het
Samd4 G T 14: 47,064,247 R336L probably damaging Het
Siglec1 T C 2: 131,071,163 N1611S probably benign Het
Skil A G 3: 31,097,602 H91R possibly damaging Het
Snip1 T C 4: 125,071,381 V193A probably benign Het
Sp2 A T 11: 96,961,837 I87N probably damaging Het
Syna T C 5: 134,559,192 H301R probably benign Het
Tdg A G 10: 82,641,382 K89R possibly damaging Het
Tdrd7 G A 4: 46,010,902 probably null Het
Trak1 G A 9: 121,460,425 R601H probably damaging Het
Utp20 A T 10: 88,770,388 N1697K probably benign Het
Uts2r G A 11: 121,160,669 V120M possibly damaging Het
Vmn2r59 A G 7: 42,046,832 L162P probably damaging Het
Zbtb17 G A 4: 141,461,823 R18Q probably damaging Het
Zfp551 A T 7: 12,417,211 C90* probably null Het
Zfp605 T A 5: 110,128,434 C473S probably damaging Het
Zfp975 A T 7: 42,662,932 Y86N probably benign Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R5969:Triobp UTSW 15 78967540 missense probably benign 0.05
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACACGCCCACATGTAGTAC -3'
(R):5'- TGAAAAGCTCAGCCTTCCTC -3'

Sequencing Primer
(F):5'- ACATGTAGTACCCGGGTGG -3'
(R):5'- CTGAGGACAGCAGGTGACC -3'
Posted On2020-01-23